FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641318_at:

>probe:Drosophila_2:1641318_at:100:599; Interrogation_Position=475; Antisense; TGTCCGCAGGCAATGATTTCACCAT
>probe:Drosophila_2:1641318_at:471:3; Interrogation_Position=522; Antisense; ATTGGCATCGGCATCTGCTACGATA
>probe:Drosophila_2:1641318_at:170:99; Interrogation_Position=559; Antisense; AGATGGCGAGGCTCTATCGCAACGC
>probe:Drosophila_2:1641318_at:382:425; Interrogation_Position=591; Antisense; GAGATGATCATCTATCCGGCTGCAT
>probe:Drosophila_2:1641318_at:614:571; Interrogation_Position=608; Antisense; GGCTGCATTCAACATGACCACTGGT
>probe:Drosophila_2:1641318_at:714:141; Interrogation_Position=627; Antisense; ACTGGTCCACTGCACTGGGAGCTAT
>probe:Drosophila_2:1641318_at:629:689; Interrogation_Position=649; Antisense; TATTGCAGCGATCCCGTGCCAATGA
>probe:Drosophila_2:1641318_at:723:505; Interrogation_Position=664; Antisense; GTGCCAATGACAACCAACTCTTTGT
>probe:Drosophila_2:1641318_at:73:399; Interrogation_Position=711; Antisense; GACACAAGCGCCGAGTATGTAGCCT
>probe:Drosophila_2:1641318_at:133:681; Interrogation_Position=726; Antisense; TATGTAGCCTATGGCCATTCCATGG
>probe:Drosophila_2:1641318_at:154:533; Interrogation_Position=806; Antisense; GGTGGCCGATATAGATTTCTCCGAG
>probe:Drosophila_2:1641318_at:253:347; Interrogation_Position=848; Antisense; GCAGATTCCCGTCTTTGGGCAAAGA
>probe:Drosophila_2:1641318_at:186:497; Interrogation_Position=874; Antisense; GTCTAGATCTGTACGCCACCGAAAG
>probe:Drosophila_2:1641318_at:273:367; Interrogation_Position=955; Antisense; GAATCTGTCGTTTTAAGCACCTTTA

Paste this into a BLAST search page for me
TGTCCGCAGGCAATGATTTCACCATATTGGCATCGGCATCTGCTACGATAAGATGGCGAGGCTCTATCGCAACGCGAGATGATCATCTATCCGGCTGCATGGCTGCATTCAACATGACCACTGGTACTGGTCCACTGCACTGGGAGCTATTATTGCAGCGATCCCGTGCCAATGAGTGCCAATGACAACCAACTCTTTGTGACACAAGCGCCGAGTATGTAGCCTTATGTAGCCTATGGCCATTCCATGGGGTGGCCGATATAGATTTCTCCGAGGCAGATTCCCGTCTTTGGGCAAAGAGTCTAGATCTGTACGCCACCGAAAGGAATCTGTCGTTTTAAGCACCTTTA

Full Affymetrix probeset data:

Annotations for 1641318_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720