Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641322_at:

>probe:Drosophila_2:1641322_at:335:31; Interrogation_Position=2356; Antisense; ATAAAGCCGGGCATGTGCTGCACCA
>probe:Drosophila_2:1641322_at:672:127; Interrogation_Position=2377; Antisense; ACCACCATCACCAATAGCTCAGGAT
>probe:Drosophila_2:1641322_at:6:675; Interrogation_Position=2391; Antisense; TAGCTCAGGATCCACGGTAAAAGGC
>probe:Drosophila_2:1641322_at:64:55; Interrogation_Position=2464; Antisense; ATGACCACCGGAAATGATGCCCATC
>probe:Drosophila_2:1641322_at:317:687; Interrogation_Position=2503; Antisense; TATAGCCTGGATGTGCCCGGCATGA
>probe:Drosophila_2:1641322_at:49:507; Interrogation_Position=2515; Antisense; GTGCCCGGCATGATGAGATACTCCT
>probe:Drosophila_2:1641322_at:565:427; Interrogation_Position=2529; Antisense; GAGATACTCCTCCAACGACAGCAGT
>probe:Drosophila_2:1641322_at:729:269; Interrogation_Position=2557; Antisense; CATCCCAGCAACAATACGCTTCAGA
>probe:Drosophila_2:1641322_at:564:505; Interrogation_Position=2594; Antisense; GTGCTGGTTTGACCACCGGATTAGA
>probe:Drosophila_2:1641322_at:296:569; Interrogation_Position=2630; Antisense; GGCAGGATGCGGTAGCCATTAGCAA
>probe:Drosophila_2:1641322_at:212:435; Interrogation_Position=2797; Antisense; GAGGTGTCCTCCATGTCGATGACCG
>probe:Drosophila_2:1641322_at:154:501; Interrogation_Position=2826; Antisense; GTCGGCGATTGGTCAGCGTTTGAAC
>probe:Drosophila_2:1641322_at:591:499; Interrogation_Position=2857; Antisense; GTCTGCCATTGCTGCGAACGCAAAT
>probe:Drosophila_2:1641322_at:103:325; Interrogation_Position=2870; Antisense; GCGAACGCAAATTACCGGAACCAGA

Paste this into a BLAST search page for me
ATAAAGCCGGGCATGTGCTGCACCAACCACCATCACCAATAGCTCAGGATTAGCTCAGGATCCACGGTAAAAGGCATGACCACCGGAAATGATGCCCATCTATAGCCTGGATGTGCCCGGCATGAGTGCCCGGCATGATGAGATACTCCTGAGATACTCCTCCAACGACAGCAGTCATCCCAGCAACAATACGCTTCAGAGTGCTGGTTTGACCACCGGATTAGAGGCAGGATGCGGTAGCCATTAGCAAGAGGTGTCCTCCATGTCGATGACCGGTCGGCGATTGGTCAGCGTTTGAACGTCTGCCATTGCTGCGAACGCAAATGCGAACGCAAATTACCGGAACCAGA

Full Affymetrix probeset data:

Annotations for 1641322_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime