FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641323_at:

>probe:Drosophila_2:1641323_at:517:35; Interrogation_Position=1206; Antisense; ATCTTCACCAGTCAACCGGCAAGGT
>probe:Drosophila_2:1641323_at:426:223; Interrogation_Position=1226; Antisense; AAGGTGGCAGCAAATCGCGACCCCG
>probe:Drosophila_2:1641323_at:103:555; Interrogation_Position=1341; Antisense; GGAGCGGGATCAGTCGACGTCACTA
>probe:Drosophila_2:1641323_at:501:567; Interrogation_Position=1377; Antisense; GGCAGTCTATCCAGTGAGCTCGATC
>probe:Drosophila_2:1641323_at:585:541; Interrogation_Position=1439; Antisense; GGATTAACTATAACTACCACCCCAT
>probe:Drosophila_2:1641323_at:59:127; Interrogation_Position=1454; Antisense; ACCACCCCATTATCGATTTCTTCGA
>probe:Drosophila_2:1641323_at:547:571; Interrogation_Position=1503; Antisense; GGCTACAGTCAGTTCCATCGCAGAA
>probe:Drosophila_2:1641323_at:670:269; Interrogation_Position=1518; Antisense; CATCGCAGAAGAGTCCCGCATAGTG
>probe:Drosophila_2:1641323_at:313:421; Interrogation_Position=1543; Antisense; GAGCAGCGTATATTCCCGCAGAATT
>probe:Drosophila_2:1641323_at:510:569; Interrogation_Position=1600; Antisense; GGCATGGAGACAATCACTGGAGTTT
>probe:Drosophila_2:1641323_at:96:143; Interrogation_Position=1615; Antisense; ACTGGAGTTTACCAACATCCCATTC
>probe:Drosophila_2:1641323_at:231:71; Interrogation_Position=1660; Antisense; AGGCGTATGGGTTACCGGGCACATA
>probe:Drosophila_2:1641323_at:186:479; Interrogation_Position=1727; Antisense; GTTTCGCTAGCGATAACGCCTGGCT
>probe:Drosophila_2:1641323_at:557:305; Interrogation_Position=1745; Antisense; CCTGGCTGCCCATGGTTGTGGAGTA

Paste this into a BLAST search page for me
ATCTTCACCAGTCAACCGGCAAGGTAAGGTGGCAGCAAATCGCGACCCCGGGAGCGGGATCAGTCGACGTCACTAGGCAGTCTATCCAGTGAGCTCGATCGGATTAACTATAACTACCACCCCATACCACCCCATTATCGATTTCTTCGAGGCTACAGTCAGTTCCATCGCAGAACATCGCAGAAGAGTCCCGCATAGTGGAGCAGCGTATATTCCCGCAGAATTGGCATGGAGACAATCACTGGAGTTTACTGGAGTTTACCAACATCCCATTCAGGCGTATGGGTTACCGGGCACATAGTTTCGCTAGCGATAACGCCTGGCTCCTGGCTGCCCATGGTTGTGGAGTA

Full Affymetrix probeset data:

Annotations for 1641323_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720