Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641324_at:

>probe:Drosophila_2:1641324_at:229:481; Interrogation_Position=11068; Antisense; GTTTGTGATCAACATAGCCGTGGAT
>probe:Drosophila_2:1641324_at:583:121; Interrogation_Position=11083; Antisense; AGCCGTGGATTTCATTAGCTCCAAC
>probe:Drosophila_2:1641324_at:301:225; Interrogation_Position=11140; Antisense; AAGGACCAATCGTCCGCTGTTCTTG
>probe:Drosophila_2:1641324_at:487:643; Interrogation_Position=11160; Antisense; TCTTGGGCGGACATGTGGCCTTCCA
>probe:Drosophila_2:1641324_at:538:373; Interrogation_Position=11209; Antisense; GAAGTCCTTTAAGGGCTGCATCAGC
>probe:Drosophila_2:1641324_at:193:191; Interrogation_Position=11261; Antisense; AACATCACGCCGAACATGGTCGTTG
>probe:Drosophila_2:1641324_at:276:293; Interrogation_Position=11281; Antisense; CGTTGGCGATATTTGGCAGGGCTAT
>probe:Drosophila_2:1641324_at:491:569; Interrogation_Position=11300; Antisense; GGCTATTGTCCCCTCAACTAATAAA
>probe:Drosophila_2:1641324_at:178:1; Interrogation_Position=11328; Antisense; CTTCGGAACGACTTAAGGACCTATG
>probe:Drosophila_2:1641324_at:482:555; Interrogation_Position=11344; Antisense; GGACCTATGATTTATTTGGACAACG
>probe:Drosophila_2:1641324_at:255:111; Interrogation_Position=11389; Antisense; AGAATCTTCTTTTGCCGACAACTGC
>probe:Drosophila_2:1641324_at:687:447; Interrogation_Position=11510; Antisense; GATGCCAGTCGTATATATTCCTAGT
>probe:Drosophila_2:1641324_at:427:489; Interrogation_Position=11533; Antisense; GTACTATAAGCCAAACTGCGTGCCA
>probe:Drosophila_2:1641324_at:79:329; Interrogation_Position=11550; Antisense; GCGTGCCAATTCTATTAAAGCCATT

Paste this into a BLAST search page for me
GTTTGTGATCAACATAGCCGTGGATAGCCGTGGATTTCATTAGCTCCAACAAGGACCAATCGTCCGCTGTTCTTGTCTTGGGCGGACATGTGGCCTTCCAGAAGTCCTTTAAGGGCTGCATCAGCAACATCACGCCGAACATGGTCGTTGCGTTGGCGATATTTGGCAGGGCTATGGCTATTGTCCCCTCAACTAATAAACTTCGGAACGACTTAAGGACCTATGGGACCTATGATTTATTTGGACAACGAGAATCTTCTTTTGCCGACAACTGCGATGCCAGTCGTATATATTCCTAGTGTACTATAAGCCAAACTGCGTGCCAGCGTGCCAATTCTATTAAAGCCATT

Full Affymetrix probeset data:

Annotations for 1641324_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime