FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641326_at:

>probe:Drosophila_2:1641326_at:676:49; Interrogation_Position=1762; Antisense; ATGCCCTGAAGAACTGCATGCCCAA
>probe:Drosophila_2:1641326_at:410:347; Interrogation_Position=1777; Antisense; GCATGCCCAAGTTCCTGAACATTGT
>probe:Drosophila_2:1641326_at:408:449; Interrogation_Position=1818; Antisense; GATCCGGACTACTCCATGTTTAATC
>probe:Drosophila_2:1641326_at:23:271; Interrogation_Position=1832; Antisense; CATGTTTAATCTATCCCTCAAGGAG
>probe:Drosophila_2:1641326_at:424:109; Interrogation_Position=1873; Antisense; AGAAGTTTTGCCGATCGGCGACGCA
>probe:Drosophila_2:1641326_at:42:315; Interrogation_Position=1919; Antisense; GCCAGTGCCGGCAAAGCAGTATCAT
>probe:Drosophila_2:1641326_at:643:525; Interrogation_Position=1967; Antisense; GGGCATGAGGCCAGGAGTCAACATA
>probe:Drosophila_2:1641326_at:231:31; Interrogation_Position=2048; Antisense; ATAAGCTTCTATCTTTCGTTGCTCC
>probe:Drosophila_2:1641326_at:489:261; Interrogation_Position=2082; Antisense; CACCTCATTTCACTTTCATTTTCTA
>probe:Drosophila_2:1641326_at:64:635; Interrogation_Position=2154; Antisense; TCGCCTGACTATGTTTCTCTTTTGA
>probe:Drosophila_2:1641326_at:384:723; Interrogation_Position=2175; Antisense; TTGATTTTGTAGTTAAGGGCGCCGC
>probe:Drosophila_2:1641326_at:584:221; Interrogation_Position=2189; Antisense; AAGGGCGCCGCTAATGGAGTCTCGA
>probe:Drosophila_2:1641326_at:639:279; Interrogation_Position=2228; Antisense; CTCAATGGTCAGTAGGCTTCCGAAC
>probe:Drosophila_2:1641326_at:688:383; Interrogation_Position=2249; Antisense; GAACTGTCCCTGAATCTCTTTTGCA

Paste this into a BLAST search page for me
ATGCCCTGAAGAACTGCATGCCCAAGCATGCCCAAGTTCCTGAACATTGTGATCCGGACTACTCCATGTTTAATCCATGTTTAATCTATCCCTCAAGGAGAGAAGTTTTGCCGATCGGCGACGCAGCCAGTGCCGGCAAAGCAGTATCATGGGCATGAGGCCAGGAGTCAACATAATAAGCTTCTATCTTTCGTTGCTCCCACCTCATTTCACTTTCATTTTCTATCGCCTGACTATGTTTCTCTTTTGATTGATTTTGTAGTTAAGGGCGCCGCAAGGGCGCCGCTAATGGAGTCTCGACTCAATGGTCAGTAGGCTTCCGAACGAACTGTCCCTGAATCTCTTTTGCA

Full Affymetrix probeset data:

Annotations for 1641326_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720