FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641327_at:

>probe:Drosophila_2:1641327_at:152:649; Interrogation_Position=2521; Antisense; TCAGGACCGGATCACACGAGCATAT
>probe:Drosophila_2:1641327_at:298:137; Interrogation_Position=2536; Antisense; ACGAGCATATTCATTCTGCCCTTAA
>probe:Drosophila_2:1641327_at:673:535; Interrogation_Position=2582; Antisense; GGTCCTTCATTAGGGATCCGCTGGA
>probe:Drosophila_2:1641327_at:551:173; Interrogation_Position=2616; Antisense; AAAGCCACCATACTACGTGTACTGG
>probe:Drosophila_2:1641327_at:157:25; Interrogation_Position=2643; Antisense; ATATGCATTAGATCCCAAACCCTTG
>probe:Drosophila_2:1641327_at:57:177; Interrogation_Position=2659; Antisense; AAACCCTTGCAGTTTTCACTGGAAT
>probe:Drosophila_2:1641327_at:3:255; Interrogation_Position=2699; Antisense; CAAATTGGTCGGGAGGCACTTTCAA
>probe:Drosophila_2:1641327_at:673:423; Interrogation_Position=2770; Antisense; GAGGATTTCCGTGAGTTCCTGGCCA
>probe:Drosophila_2:1641327_at:587:59; Interrogation_Position=2813; Antisense; ATGTTAGCTCCTGGCTGGGATCCTA
>probe:Drosophila_2:1641327_at:335:529; Interrogation_Position=2829; Antisense; GGGATCCTACAATAGTTGGCAGCTT
>probe:Drosophila_2:1641327_at:223:597; Interrogation_Position=2858; Antisense; TGTAGACTCAAAGTTCCTTCACGAA
>probe:Drosophila_2:1641327_at:359:193; Interrogation_Position=2886; Antisense; AACTCAATCCCATTTTTGCCATGAC
>probe:Drosophila_2:1641327_at:510:55; Interrogation_Position=2906; Antisense; ATGACACCTCAGCTACTCTTAATTC
>probe:Drosophila_2:1641327_at:321:595; Interrogation_Position=2980; Antisense; TGTCGATAAGCATGGCACGTCCTAA

Paste this into a BLAST search page for me
TCAGGACCGGATCACACGAGCATATACGAGCATATTCATTCTGCCCTTAAGGTCCTTCATTAGGGATCCGCTGGAAAAGCCACCATACTACGTGTACTGGATATGCATTAGATCCCAAACCCTTGAAACCCTTGCAGTTTTCACTGGAATCAAATTGGTCGGGAGGCACTTTCAAGAGGATTTCCGTGAGTTCCTGGCCAATGTTAGCTCCTGGCTGGGATCCTAGGGATCCTACAATAGTTGGCAGCTTTGTAGACTCAAAGTTCCTTCACGAAAACTCAATCCCATTTTTGCCATGACATGACACCTCAGCTACTCTTAATTCTGTCGATAAGCATGGCACGTCCTAA

Full Affymetrix probeset data:

Annotations for 1641327_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720