FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641328_at:

>probe:Drosophila_2:1641328_at:476:521; Interrogation_Position=115; Antisense; GTGGCATGCGTGTCCTGCGCACAGA
>probe:Drosophila_2:1641328_at:614:263; Interrogation_Position=136; Antisense; CAGAGGCCCGTCGTAACTTCGGAAT
>probe:Drosophila_2:1641328_at:266:49; Interrogation_Position=195; Antisense; ATCCAGCAGCTGTTCCTGGACAAAG
>probe:Drosophila_2:1641328_at:662:159; Interrogation_Position=229; Antisense; ACAAGCAGAAGAGCGCCGGTGGCAA
>probe:Drosophila_2:1641328_at:88:533; Interrogation_Position=257; Antisense; GGTGGACTCCAATCCCGATATTGAG
>probe:Drosophila_2:1641328_at:275:213; Interrogation_Position=291; Antisense; AAGACCGAACTGGACCGTGTGGCCA
>probe:Drosophila_2:1641328_at:715:399; Interrogation_Position=342; Antisense; GACATGCTGAAGTTCCCCGAATTCC
>probe:Drosophila_2:1641328_at:507:285; Interrogation_Position=359; Antisense; CGAATTCCAGTTCCCCGATGTTAAG
>probe:Drosophila_2:1641328_at:78:443; Interrogation_Position=375; Antisense; GATGTTAAGGTCGATCCCATCACCC
>probe:Drosophila_2:1641328_at:576:69; Interrogation_Position=400; Antisense; AGGCCCCACAGTAGAGATCGCTCTT
>probe:Drosophila_2:1641328_at:285:635; Interrogation_Position=417; Antisense; TCGCTCTTCGCGAATGAGTTAGTCT
>probe:Drosophila_2:1641328_at:85:397; Interrogation_Position=42; Antisense; GACAATTGTAACTTTTCCGCACGAA
>probe:Drosophila_2:1641328_at:625:247; Interrogation_Position=442; Antisense; AATTGCTTTAAGTTCAGCTGCTGAT
>probe:Drosophila_2:1641328_at:657:237; Interrogation_Position=87; Antisense; AATAAGATGCTGTCGCAATCCCTGC

Paste this into a BLAST search page for me
GTGGCATGCGTGTCCTGCGCACAGACAGAGGCCCGTCGTAACTTCGGAATATCCAGCAGCTGTTCCTGGACAAAGACAAGCAGAAGAGCGCCGGTGGCAAGGTGGACTCCAATCCCGATATTGAGAAGACCGAACTGGACCGTGTGGCCAGACATGCTGAAGTTCCCCGAATTCCCGAATTCCAGTTCCCCGATGTTAAGGATGTTAAGGTCGATCCCATCACCCAGGCCCCACAGTAGAGATCGCTCTTTCGCTCTTCGCGAATGAGTTAGTCTGACAATTGTAACTTTTCCGCACGAAAATTGCTTTAAGTTCAGCTGCTGATAATAAGATGCTGTCGCAATCCCTGC

Full Affymetrix probeset data:

Annotations for 1641328_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720