Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641329_at:

>probe:Drosophila_2:1641329_at:89:59; Interrogation_Position=5290; Antisense; ATGATGCCCCAGAGCAATGCGCAAC
>probe:Drosophila_2:1641329_at:541:55; Interrogation_Position=5372; Antisense; AGTCGACCAACTCTTCGGGCGTGCG
>probe:Drosophila_2:1641329_at:463:523; Interrogation_Position=5388; Antisense; GGGCGTGCGTCCATGTCCGTACAAC
>probe:Drosophila_2:1641329_at:311:491; Interrogation_Position=5406; Antisense; GTACAACTTCCTCGTCGAGCTGGAT
>probe:Drosophila_2:1641329_at:59:649; Interrogation_Position=5438; Antisense; TCAGCTCCGACGAATGCATCACGAT
>probe:Drosophila_2:1641329_at:707:345; Interrogation_Position=5453; Antisense; GCATCACGATCCTGCGCAAACAGAT
>probe:Drosophila_2:1641329_at:318:77; Interrogation_Position=5480; Antisense; AGGATCTGCGCAAGGCCTACAATAC
>probe:Drosophila_2:1641329_at:160:251; Interrogation_Position=5508; Antisense; CAAGGGCGAACTGGCGGTTATCGAT
>probe:Drosophila_2:1641329_at:566:23; Interrogation_Position=5608; Antisense; ATATGCGCCTAGCTTGGGTGGCATT
>probe:Drosophila_2:1641329_at:246:521; Interrogation_Position=5625; Antisense; GTGGCATTCACATCAGCGCGTGTTG
>probe:Drosophila_2:1641329_at:701:721; Interrogation_Position=5647; Antisense; TTGCGCAACGACTCTCCTATTTAAT
>probe:Drosophila_2:1641329_at:436:403; Interrogation_Position=5656; Antisense; GACTCTCCTATTTAATCTTGTGCAA
>probe:Drosophila_2:1641329_at:166:677; Interrogation_Position=5694; Antisense; TAGACCGACAGGAGAGCACGTTGCA
>probe:Drosophila_2:1641329_at:5:421; Interrogation_Position=5707; Antisense; GAGCACGTTGCAAGTGTCGTTTATA

Paste this into a BLAST search page for me
ATGATGCCCCAGAGCAATGCGCAACAGTCGACCAACTCTTCGGGCGTGCGGGGCGTGCGTCCATGTCCGTACAACGTACAACTTCCTCGTCGAGCTGGATTCAGCTCCGACGAATGCATCACGATGCATCACGATCCTGCGCAAACAGATAGGATCTGCGCAAGGCCTACAATACCAAGGGCGAACTGGCGGTTATCGATATATGCGCCTAGCTTGGGTGGCATTGTGGCATTCACATCAGCGCGTGTTGTTGCGCAACGACTCTCCTATTTAATGACTCTCCTATTTAATCTTGTGCAATAGACCGACAGGAGAGCACGTTGCAGAGCACGTTGCAAGTGTCGTTTATA

Full Affymetrix probeset data:

Annotations for 1641329_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime