FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641330_at:

>probe:Drosophila_2:1641330_at:531:707; Interrogation_Position=111; Antisense; TTACTCTGCTCCTCTAGACTACTCT
>probe:Drosophila_2:1641330_at:439:641; Interrogation_Position=133; Antisense; TCTGCTCTCGCTGCCGTGGTAACTG
>probe:Drosophila_2:1641330_at:584:261; Interrogation_Position=180; Antisense; CACCAGTATCGCCAGGAACAACAAT
>probe:Drosophila_2:1641330_at:512:163; Interrogation_Position=19; Antisense; AAATACGCCGTCCTTGTCCTGATAA
>probe:Drosophila_2:1641330_at:301:387; Interrogation_Position=195; Antisense; GAACAACAATGGAATCGATGCTGCT
>probe:Drosophila_2:1641330_at:647:227; Interrogation_Position=202; Antisense; AATGGAATCGATGCTGCTTCTGAGA
>probe:Drosophila_2:1641330_at:262:53; Interrogation_Position=212; Antisense; ATGCTGCTTCTGAGATTGCTTCCGT
>probe:Drosophila_2:1641330_at:658:95; Interrogation_Position=224; Antisense; AGATTGCTTCCGTTGCTGCTCCAGT
>probe:Drosophila_2:1641330_at:533:89; Interrogation_Position=257; Antisense; AGTACGCTGCTGCTTCTTTGGCCTA
>probe:Drosophila_2:1641330_at:581:579; Interrogation_Position=275; Antisense; TGGCCTACCCTTCGCGTTTGGCCAA
>probe:Drosophila_2:1641330_at:533:479; Interrogation_Position=290; Antisense; GTTTGGCCAACTCCGCTCCAATCAG
>probe:Drosophila_2:1641330_at:610:621; Interrogation_Position=324; Antisense; TGCTGCTGCGCAGGTCATCATCTAA
>probe:Drosophila_2:1641330_at:397:39; Interrogation_Position=71; Antisense; ATCTCCTGGGTGCTGCCCTGGCGTA
>probe:Drosophila_2:1641330_at:164:583; Interrogation_Position=89; Antisense; TGGCGTACACTGGTCCTCTGGCTTA

Paste this into a BLAST search page for me
TTACTCTGCTCCTCTAGACTACTCTTCTGCTCTCGCTGCCGTGGTAACTGCACCAGTATCGCCAGGAACAACAATAAATACGCCGTCCTTGTCCTGATAAGAACAACAATGGAATCGATGCTGCTAATGGAATCGATGCTGCTTCTGAGAATGCTGCTTCTGAGATTGCTTCCGTAGATTGCTTCCGTTGCTGCTCCAGTAGTACGCTGCTGCTTCTTTGGCCTATGGCCTACCCTTCGCGTTTGGCCAAGTTTGGCCAACTCCGCTCCAATCAGTGCTGCTGCGCAGGTCATCATCTAAATCTCCTGGGTGCTGCCCTGGCGTATGGCGTACACTGGTCCTCTGGCTTA

Full Affymetrix probeset data:

Annotations for 1641330_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720