Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641331_at:

>probe:Drosophila_2:1641331_at:443:465; Interrogation_Position=1642; Antisense; GATTGCTGCGCTATCACCTGGGCAG
>probe:Drosophila_2:1641331_at:199:355; Interrogation_Position=1679; Antisense; GCACCAGGTGCATGCCGTACTGCAG
>probe:Drosophila_2:1641331_at:556:489; Interrogation_Position=1695; Antisense; GTACTGCAGCTCTATCCGGAGGAGA
>probe:Drosophila_2:1641331_at:212:549; Interrogation_Position=1712; Antisense; GGAGGAGACCGACGCCAAGACCATA
>probe:Drosophila_2:1641331_at:501:307; Interrogation_Position=1732; Antisense; CCATATGCGCGGCTATTCTTAATTT
>probe:Drosophila_2:1641331_at:214:19; Interrogation_Position=1757; Antisense; ATTTCCGCATAATTAGGCTAGGCTT
>probe:Drosophila_2:1641331_at:717:705; Interrogation_Position=1811; Antisense; TTACACGCGTGTTTCTGCTTAAAGT
>probe:Drosophila_2:1641331_at:501:135; Interrogation_Position=1857; Antisense; ACGTGGAGTCCTCGCTCGAAATTTA
>probe:Drosophila_2:1641331_at:642:293; Interrogation_Position=1873; Antisense; CGAAATTTACATATCCAGGCCAACG
>probe:Drosophila_2:1641331_at:160:137; Interrogation_Position=1895; Antisense; ACGATGTTGGCCGTGTCGTAGGACA
>probe:Drosophila_2:1641331_at:191:609; Interrogation_Position=1968; Antisense; TGACCCGGTGGTTACGCAGTTTGTA
>probe:Drosophila_2:1641331_at:486:91; Interrogation_Position=1985; Antisense; AGTTTGTACGCCTGCGGGAATCCCT
>probe:Drosophila_2:1641331_at:576:29; Interrogation_Position=2115; Antisense; ATACTTCATTCCCTGTTTATCTAAT
>probe:Drosophila_2:1641331_at:132:657; Interrogation_Position=2136; Antisense; TAATGTTATTTACGCCTCAGGCACC

Paste this into a BLAST search page for me
GATTGCTGCGCTATCACCTGGGCAGGCACCAGGTGCATGCCGTACTGCAGGTACTGCAGCTCTATCCGGAGGAGAGGAGGAGACCGACGCCAAGACCATACCATATGCGCGGCTATTCTTAATTTATTTCCGCATAATTAGGCTAGGCTTTTACACGCGTGTTTCTGCTTAAAGTACGTGGAGTCCTCGCTCGAAATTTACGAAATTTACATATCCAGGCCAACGACGATGTTGGCCGTGTCGTAGGACATGACCCGGTGGTTACGCAGTTTGTAAGTTTGTACGCCTGCGGGAATCCCTATACTTCATTCCCTGTTTATCTAATTAATGTTATTTACGCCTCAGGCACC

Full Affymetrix probeset data:

Annotations for 1641331_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime