Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641332_at:

>probe:Drosophila_2:1641332_at:284:413; Interrogation_Position=4060; Antisense; GACCGATTCTTTATCCTTGTGCAAT
>probe:Drosophila_2:1641332_at:71:479; Interrogation_Position=4128; Antisense; GTATTGCCTCTACCATTAAGTTAAG
>probe:Drosophila_2:1641332_at:657:511; Interrogation_Position=4259; Antisense; GTGACATTTCCCGAATGGACACTTC
>probe:Drosophila_2:1641332_at:140:559; Interrogation_Position=4275; Antisense; GGACACTTCGTAGGTTTCATACTTT
>probe:Drosophila_2:1641332_at:348:711; Interrogation_Position=4337; Antisense; TTCAGAAGTTATTCGCACTGTCCAT
>probe:Drosophila_2:1641332_at:632:355; Interrogation_Position=4351; Antisense; GCACTGTCCATCGATCACTTATTTA
>probe:Drosophila_2:1641332_at:150:689; Interrogation_Position=4370; Antisense; TATTTATCCATCCATTTGCACACAC
>probe:Drosophila_2:1641332_at:581:105; Interrogation_Position=4476; Antisense; AGACACTCTTCGTAGGTCCATTTGG
>probe:Drosophila_2:1641332_at:515:563; Interrogation_Position=4501; Antisense; GGAAGACTCTCTTGTACAGGTACAT
>probe:Drosophila_2:1641332_at:293:173; Interrogation_Position=4527; Antisense; AAAGCAGTGTCGTAGGATCGCAACT
>probe:Drosophila_2:1641332_at:306:217; Interrogation_Position=4560; Antisense; AAGTAGCACTTCATGTGGCCGTGCG
>probe:Drosophila_2:1641332_at:310:507; Interrogation_Position=4584; Antisense; GTGCCCAGTGACTCCTTAATGTGTC
>probe:Drosophila_2:1641332_at:279:633; Interrogation_Position=4616; Antisense; TCCGCACTTGGTTCTTAGTTTCACA
>probe:Drosophila_2:1641332_at:689:477; Interrogation_Position=4633; Antisense; GTTTCACAGGCTTGAAGTACTCCAC

Paste this into a BLAST search page for me
GACCGATTCTTTATCCTTGTGCAATGTATTGCCTCTACCATTAAGTTAAGGTGACATTTCCCGAATGGACACTTCGGACACTTCGTAGGTTTCATACTTTTTCAGAAGTTATTCGCACTGTCCATGCACTGTCCATCGATCACTTATTTATATTTATCCATCCATTTGCACACACAGACACTCTTCGTAGGTCCATTTGGGGAAGACTCTCTTGTACAGGTACATAAAGCAGTGTCGTAGGATCGCAACTAAGTAGCACTTCATGTGGCCGTGCGGTGCCCAGTGACTCCTTAATGTGTCTCCGCACTTGGTTCTTAGTTTCACAGTTTCACAGGCTTGAAGTACTCCAC

Full Affymetrix probeset data:

Annotations for 1641332_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime