FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641334_at:

>probe:Drosophila_2:1641334_at:589:229; Interrogation_Position=108; Antisense; AATGACCGATCTGCGCAACGAGATG
>probe:Drosophila_2:1641334_at:255:193; Interrogation_Position=151; Antisense; AACTACTCCCTGAACAGCAATGCGG
>probe:Drosophila_2:1641334_at:219:53; Interrogation_Position=187; Antisense; ATGCAGGAGCTGACCATATACGTAC
>probe:Drosophila_2:1641334_at:159:469; Interrogation_Position=240; Antisense; GTTCCAGACGATGTCGGACCAGATA
>probe:Drosophila_2:1641334_at:200:241; Interrogation_Position=264; Antisense; AATAACGCGCATCGATGACATGGGC
>probe:Drosophila_2:1641334_at:692:611; Interrogation_Position=279; Antisense; TGACATGGGCAACCGCATCGACGAT
>probe:Drosophila_2:1641334_at:572:39; Interrogation_Position=323; Antisense; ATCTGATGAACCAGGCCGGGATCGA
>probe:Drosophila_2:1641334_at:680:167; Interrogation_Position=364; Antisense; AAATGAGATCCGTAGCGCTGGCACG
>probe:Drosophila_2:1641334_at:126:321; Interrogation_Position=394; Antisense; GCCCATTCGGAAAGTGCATCCCAAT
>probe:Drosophila_2:1641334_at:693:455; Interrogation_Position=426; Antisense; GATACATACATCGAACACCTGGCAC
>probe:Drosophila_2:1641334_at:354:307; Interrogation_Position=451; Antisense; CCAGTCACCCGTATCAAGTTTACAA
>probe:Drosophila_2:1641334_at:107:163; Interrogation_Position=472; Antisense; ACAATTCCAGGTTCTCACATTCATT
>probe:Drosophila_2:1641334_at:356:309; Interrogation_Position=512; Antisense; CCAGCTGCTCCCCAAGAAATGAAGA
>probe:Drosophila_2:1641334_at:326:385; Interrogation_Position=540; Antisense; GAACACATTTGCTCATCCATTTATT

Paste this into a BLAST search page for me
AATGACCGATCTGCGCAACGAGATGAACTACTCCCTGAACAGCAATGCGGATGCAGGAGCTGACCATATACGTACGTTCCAGACGATGTCGGACCAGATAAATAACGCGCATCGATGACATGGGCTGACATGGGCAACCGCATCGACGATATCTGATGAACCAGGCCGGGATCGAAAATGAGATCCGTAGCGCTGGCACGGCCCATTCGGAAAGTGCATCCCAATGATACATACATCGAACACCTGGCACCCAGTCACCCGTATCAAGTTTACAAACAATTCCAGGTTCTCACATTCATTCCAGCTGCTCCCCAAGAAATGAAGAGAACACATTTGCTCATCCATTTATT

Full Affymetrix probeset data:

Annotations for 1641334_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720