Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641335_at:

>probe:Drosophila_2:1641335_at:164:125; Interrogation_Position=1404; Antisense; AGCCATTGCGGATTTGGTCTTCCGG
>probe:Drosophila_2:1641335_at:443:693; Interrogation_Position=1451; Antisense; TTGGCCTGAAAAACGGCGACACTCA
>probe:Drosophila_2:1641335_at:259:325; Interrogation_Position=1466; Antisense; GCGACACTCACATCATGACACTGGA
>probe:Drosophila_2:1641335_at:652:547; Interrogation_Position=1488; Antisense; GGATGAGTCCATGCGACAGGCAACT
>probe:Drosophila_2:1641335_at:140:77; Interrogation_Position=1517; Antisense; AGGAGAAGGCACTCATGGCCGCCAT
>probe:Drosophila_2:1641335_at:474:511; Interrogation_Position=1563; Antisense; GTGTAAACTACTGGAGGCTCGCTAT
>probe:Drosophila_2:1641335_at:194:389; Interrogation_Position=1608; Antisense; GAAAACGCTTCAAATGGCCGAGGAG
>probe:Drosophila_2:1641335_at:221:397; Interrogation_Position=1684; Antisense; GACAATCCCGATCAGTTTGTGATGA
>probe:Drosophila_2:1641335_at:152:613; Interrogation_Position=1722; Antisense; TGAAGAATTTCGCACGGCCATCACC
>probe:Drosophila_2:1641335_at:149:379; Interrogation_Position=1779; Antisense; GAAGCGTTCCAAGCGGCAGGTGATC
>probe:Drosophila_2:1641335_at:168:81; Interrogation_Position=1796; Antisense; AGGTGATCATGGAGCGTACGGTCTT
>probe:Drosophila_2:1641335_at:683:563; Interrogation_Position=1829; Antisense; GGAATCCGGCTGACGAAAAGCTTCA
>probe:Drosophila_2:1641335_at:531:183; Interrogation_Position=1844; Antisense; AAAAGCTTCAGGGTGAGCCCGTCGT
>probe:Drosophila_2:1641335_at:347:415; Interrogation_Position=1930; Antisense; GAGCCAAGAGCTTCGCAAGGATCCA

Paste this into a BLAST search page for me
AGCCATTGCGGATTTGGTCTTCCGGTTGGCCTGAAAAACGGCGACACTCAGCGACACTCACATCATGACACTGGAGGATGAGTCCATGCGACAGGCAACTAGGAGAAGGCACTCATGGCCGCCATGTGTAAACTACTGGAGGCTCGCTATGAAAACGCTTCAAATGGCCGAGGAGGACAATCCCGATCAGTTTGTGATGATGAAGAATTTCGCACGGCCATCACCGAAGCGTTCCAAGCGGCAGGTGATCAGGTGATCATGGAGCGTACGGTCTTGGAATCCGGCTGACGAAAAGCTTCAAAAAGCTTCAGGGTGAGCCCGTCGTGAGCCAAGAGCTTCGCAAGGATCCA

Full Affymetrix probeset data:

Annotations for 1641335_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime