Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641336_at:

>probe:Drosophila_2:1641336_at:458:577; Interrogation_Position=1003; Antisense; GGCCAGCGATGTTTACAAGTCCCTT
>probe:Drosophila_2:1641336_at:114:387; Interrogation_Position=1046; Antisense; GAAAAGGACCAGGAGCGCGCCCACT
>probe:Drosophila_2:1641336_at:600:531; Interrogation_Position=1071; Antisense; GGGTCACCTATAATCCATTCTACAA
>probe:Drosophila_2:1641336_at:100:515; Interrogation_Position=1123; Antisense; GTGTTAACTCAGTCACATGTCCATA
>probe:Drosophila_2:1641336_at:482:447; Interrogation_Position=603; Antisense; GATGCGTTTTATCAGAGCGTGCCTT
>probe:Drosophila_2:1641336_at:584:223; Interrogation_Position=639; Antisense; AAGGCAGTGTGGCTAGCACTTGTCC
>probe:Drosophila_2:1641336_at:123:313; Interrogation_Position=669; Antisense; GCCAGGCTGCCTATAGCGTTGAGGA
>probe:Drosophila_2:1641336_at:433:139; Interrogation_Position=693; Antisense; ACGTGGTGGTCCTCAATGGCAACGA
>probe:Drosophila_2:1641336_at:139:75; Interrogation_Position=720; Antisense; AGGACATGGAGCTCATGCGGGTCAA
>probe:Drosophila_2:1641336_at:701:231; Interrogation_Position=751; Antisense; AATGCGTGCGGCCAAGCGTAAGTCC
>probe:Drosophila_2:1641336_at:516:385; Interrogation_Position=833; Antisense; GAACAGGAGCCAGTGGCGTCCACAT
>probe:Drosophila_2:1641336_at:339:407; Interrogation_Position=924; Antisense; GACTGGGCGCCGTTAATGCAATGCA
>probe:Drosophila_2:1641336_at:71:79; Interrogation_Position=948; Antisense; AGGATCCCGAACTGAAGCGTCTCAA
>probe:Drosophila_2:1641336_at:492:213; Interrogation_Position=971; Antisense; AAGAGCGACTTCAGCGTGGCCAAGG

Paste this into a BLAST search page for me
GGCCAGCGATGTTTACAAGTCCCTTGAAAAGGACCAGGAGCGCGCCCACTGGGTCACCTATAATCCATTCTACAAGTGTTAACTCAGTCACATGTCCATAGATGCGTTTTATCAGAGCGTGCCTTAAGGCAGTGTGGCTAGCACTTGTCCGCCAGGCTGCCTATAGCGTTGAGGAACGTGGTGGTCCTCAATGGCAACGAAGGACATGGAGCTCATGCGGGTCAAAATGCGTGCGGCCAAGCGTAAGTCCGAACAGGAGCCAGTGGCGTCCACATGACTGGGCGCCGTTAATGCAATGCAAGGATCCCGAACTGAAGCGTCTCAAAAGAGCGACTTCAGCGTGGCCAAGG

Full Affymetrix probeset data:

Annotations for 1641336_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime