FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641337_at:

>probe:Drosophila_2:1641337_at:206:9; Interrogation_Position=1000; Antisense; ATTCCAGCAGAAGTTTCAGGCCCCG
>probe:Drosophila_2:1641337_at:33:69; Interrogation_Position=1017; Antisense; AGGCCCCGCTAAAACGTGCAATCTA
>probe:Drosophila_2:1641337_at:218:509; Interrogation_Position=1032; Antisense; GTGCAATCTAGTCAAGTGGGCTTCT
>probe:Drosophila_2:1641337_at:313:571; Interrogation_Position=1050; Antisense; GGCTTCTTCTGGTTTTCATTTTCGA
>probe:Drosophila_2:1641337_at:298:491; Interrogation_Position=1083; Antisense; GTACAATACTCACTCGTTACATGAT
>probe:Drosophila_2:1641337_at:406:387; Interrogation_Position=1187; Antisense; GAAAACCAGGTTGCGCCGAGAGTTA
>probe:Drosophila_2:1641337_at:348:675; Interrogation_Position=685; Antisense; TAGTTCCACGGCAAAAACGACCAGT
>probe:Drosophila_2:1641337_at:400:493; Interrogation_Position=708; Antisense; GTCAACAGGGTACGCAACTCAACAA
>probe:Drosophila_2:1641337_at:194:617; Interrogation_Position=745; Antisense; TGCAGCAAAATTCACACCGGACAGG
>probe:Drosophila_2:1641337_at:365:559; Interrogation_Position=830; Antisense; GGACAAGCGATCTTTACCACAGATG
>probe:Drosophila_2:1641337_at:87:587; Interrogation_Position=874; Antisense; TGGACGCTGGATGCTTCATCATAAG
>probe:Drosophila_2:1641337_at:597:585; Interrogation_Position=906; Antisense; TGGAAGCAGCAGAGGCCTTAGCCAA
>probe:Drosophila_2:1641337_at:333:323; Interrogation_Position=952; Antisense; GCGCTGGCACCATATCTAAAGACTG
>probe:Drosophila_2:1641337_at:45:615; Interrogation_Position=975; Antisense; TGAAGACTCCGGAACTGACGCCATC

Paste this into a BLAST search page for me
ATTCCAGCAGAAGTTTCAGGCCCCGAGGCCCCGCTAAAACGTGCAATCTAGTGCAATCTAGTCAAGTGGGCTTCTGGCTTCTTCTGGTTTTCATTTTCGAGTACAATACTCACTCGTTACATGATGAAAACCAGGTTGCGCCGAGAGTTATAGTTCCACGGCAAAAACGACCAGTGTCAACAGGGTACGCAACTCAACAATGCAGCAAAATTCACACCGGACAGGGGACAAGCGATCTTTACCACAGATGTGGACGCTGGATGCTTCATCATAAGTGGAAGCAGCAGAGGCCTTAGCCAAGCGCTGGCACCATATCTAAAGACTGTGAAGACTCCGGAACTGACGCCATC

Full Affymetrix probeset data:

Annotations for 1641337_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720