FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641338_at:

>probe:Drosophila_2:1641338_at:517:43; Interrogation_Position=1572; Antisense; ATCGACGGTGAGTAGATGAACGCTA
>probe:Drosophila_2:1641338_at:216:445; Interrogation_Position=1586; Antisense; GATGAACGCTAAGCATTGCCATTTA
>probe:Drosophila_2:1641338_at:414:207; Interrogation_Position=1596; Antisense; AAGCATTGCCATTTAGCCATGTAGC
>probe:Drosophila_2:1641338_at:346:345; Interrogation_Position=1598; Antisense; GCATTGCCATTTAGCCATGTAGCCT
>probe:Drosophila_2:1641338_at:87:719; Interrogation_Position=1601; Antisense; TTGCCATTTAGCCATGTAGCCTTAG
>probe:Drosophila_2:1641338_at:168:17; Interrogation_Position=1606; Antisense; ATTTAGCCATGTAGCCTTAGCCAGA
>probe:Drosophila_2:1641338_at:12:675; Interrogation_Position=1609; Antisense; TAGCCATGTAGCCTTAGCCAGAACC
>probe:Drosophila_2:1641338_at:558:269; Interrogation_Position=1613; Antisense; CATGTAGCCTTAGCCAGAACCGAGC
>probe:Drosophila_2:1641338_at:585:487; Interrogation_Position=1616; Antisense; GTAGCCTTAGCCAGAACCGAGCTAG
>probe:Drosophila_2:1641338_at:656:673; Interrogation_Position=1623; Antisense; TAGCCAGAACCGAGCTAGCACCACT
>probe:Drosophila_2:1641338_at:691:199; Interrogation_Position=1630; Antisense; AACCGAGCTAGCACCACTACAACTA
>probe:Drosophila_2:1641338_at:515:277; Interrogation_Position=1658; Antisense; CTACTACAAGTAAACCACACACAAA
>probe:Drosophila_2:1641338_at:301:491; Interrogation_Position=1667; Antisense; GTAAACCACACACAAAAGAATCTTC
>probe:Drosophila_2:1641338_at:340:159; Interrogation_Position=1678; Antisense; ACAAAAGAATCTTCTTCTCTCTGAG

Paste this into a BLAST search page for me
ATCGACGGTGAGTAGATGAACGCTAGATGAACGCTAAGCATTGCCATTTAAAGCATTGCCATTTAGCCATGTAGCGCATTGCCATTTAGCCATGTAGCCTTTGCCATTTAGCCATGTAGCCTTAGATTTAGCCATGTAGCCTTAGCCAGATAGCCATGTAGCCTTAGCCAGAACCCATGTAGCCTTAGCCAGAACCGAGCGTAGCCTTAGCCAGAACCGAGCTAGTAGCCAGAACCGAGCTAGCACCACTAACCGAGCTAGCACCACTACAACTACTACTACAAGTAAACCACACACAAAGTAAACCACACACAAAAGAATCTTCACAAAAGAATCTTCTTCTCTCTGAG

Full Affymetrix probeset data:

Annotations for 1641338_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720