FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641339_at:

>probe:Drosophila_2:1641339_at:570:587; Interrogation_Position=2647; Antisense; TGGAGGTTGCTGCTCTGAACTACCA
>probe:Drosophila_2:1641339_at:236:611; Interrogation_Position=2662; Antisense; TGAACTACCACCTGACAACGGAATG
>probe:Drosophila_2:1641339_at:667:223; Interrogation_Position=2694; Antisense; AAGGAGAGCTACGTGGTCTGTGTCC
>probe:Drosophila_2:1641339_at:324:285; Interrogation_Position=2711; Antisense; CTGTGTCCGTTGCACTGAATCGGTG
>probe:Drosophila_2:1641339_at:660:611; Interrogation_Position=2785; Antisense; TGAAAACGGGTGCTGCTCGATGTCC
>probe:Drosophila_2:1641339_at:62:63; Interrogation_Position=2804; Antisense; ATGTCCCCTTTGTCATGACGATGTT
>probe:Drosophila_2:1641339_at:31:575; Interrogation_Position=2844; Antisense; GGCGGCTGGAAATTGCATCTCCTCA
>probe:Drosophila_2:1641339_at:555:571; Interrogation_Position=2877; Antisense; GGCTGTCCCGGGAATATACGCAAGA
>probe:Drosophila_2:1641339_at:52:123; Interrogation_Position=2927; Antisense; AGCGTACACTTAATCGATCTATTGG
>probe:Drosophila_2:1641339_at:449:453; Interrogation_Position=2942; Antisense; GATCTATTGGCCTAGCGAATTAGCG
>probe:Drosophila_2:1641339_at:173:277; Interrogation_Position=3013; Antisense; CTATCTAATTTCAGTCGCAGCAGCC
>probe:Drosophila_2:1641339_at:103:353; Interrogation_Position=3029; Antisense; GCAGCAGCCGAACTCATTTAGTTAA
>probe:Drosophila_2:1641339_at:318:175; Interrogation_Position=3060; Antisense; AAACCAATTCGTTTCTCACTCAGAG
>probe:Drosophila_2:1641339_at:291:125; Interrogation_Position=3214; Antisense; AGCCCATCCATACCGTTTTAAACAT

Paste this into a BLAST search page for me
TGGAGGTTGCTGCTCTGAACTACCATGAACTACCACCTGACAACGGAATGAAGGAGAGCTACGTGGTCTGTGTCCCTGTGTCCGTTGCACTGAATCGGTGTGAAAACGGGTGCTGCTCGATGTCCATGTCCCCTTTGTCATGACGATGTTGGCGGCTGGAAATTGCATCTCCTCAGGCTGTCCCGGGAATATACGCAAGAAGCGTACACTTAATCGATCTATTGGGATCTATTGGCCTAGCGAATTAGCGCTATCTAATTTCAGTCGCAGCAGCCGCAGCAGCCGAACTCATTTAGTTAAAAACCAATTCGTTTCTCACTCAGAGAGCCCATCCATACCGTTTTAAACAT

Full Affymetrix probeset data:

Annotations for 1641339_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720