Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641340_s_at:

>probe:Drosophila_2:1641340_s_at:216:251; Interrogation_Position=361; Antisense; CAAGGCAGCCAATGCGCCCAAGGCA
>probe:Drosophila_2:1641340_s_at:394:371; Interrogation_Position=508; Antisense; GAAGGTTCAAATGATGCTTTCCAAA
>probe:Drosophila_2:1641340_s_at:680:705; Interrogation_Position=754; Antisense; TTACCTATCTTCCTACTCCGATTAC
>probe:Drosophila_2:1641340_s_at:689:273; Interrogation_Position=762; Antisense; CTTCCTACTCCGATTACTATGATTC
>probe:Drosophila_2:1641340_s_at:321:279; Interrogation_Position=766; Antisense; CTACTCCGATTACTATGATTCCGCG
>probe:Drosophila_2:1641340_s_at:513:13; Interrogation_Position=774; Antisense; ATTACTATGATTCCGCGGATGAGCA
>probe:Drosophila_2:1641340_s_at:324:445; Interrogation_Position=791; Antisense; GATGAGCAGCTCAATCCGAAGACTT
>probe:Drosophila_2:1641340_s_at:14:421; Interrogation_Position=794; Antisense; GAGCAGCTCAATCCGAAGACTTATC
>probe:Drosophila_2:1641340_s_at:442:45; Interrogation_Position=804; Antisense; ATCCGAAGACTTATCGCGCTCAGGT
>probe:Drosophila_2:1641340_s_at:626:437; Interrogation_Position=833; Antisense; GAGGACGAAGATTAGACATATTCAT
>probe:Drosophila_2:1641340_s_at:430:105; Interrogation_Position=846; Antisense; AGACATATTCATTTGTTGCTACATT
>probe:Drosophila_2:1641340_s_at:277:13; Interrogation_Position=852; Antisense; ATTCATTTGTTGCTACATTTGTACC
>probe:Drosophila_2:1641340_s_at:350:339; Interrogation_Position=863; Antisense; GCTACATTTGTACCAATTTTCTAAA
>probe:Drosophila_2:1641340_s_at:29:663; Interrogation_Position=884; Antisense; TAAATAAATCGCATACTATATACGT

Paste this into a BLAST search page for me
CAAGGCAGCCAATGCGCCCAAGGCAGAAGGTTCAAATGATGCTTTCCAAATTACCTATCTTCCTACTCCGATTACCTTCCTACTCCGATTACTATGATTCCTACTCCGATTACTATGATTCCGCGATTACTATGATTCCGCGGATGAGCAGATGAGCAGCTCAATCCGAAGACTTGAGCAGCTCAATCCGAAGACTTATCATCCGAAGACTTATCGCGCTCAGGTGAGGACGAAGATTAGACATATTCATAGACATATTCATTTGTTGCTACATTATTCATTTGTTGCTACATTTGTACCGCTACATTTGTACCAATTTTCTAAATAAATAAATCGCATACTATATACGT

Full Affymetrix probeset data:

Annotations for 1641340_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime