FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641341_at:

>probe:Drosophila_2:1641341_at:72:653; Interrogation_Position=2206; Antisense; TCAAGTACGGATTCCCCGATGGCGA
>probe:Drosophila_2:1641341_at:172:441; Interrogation_Position=2223; Antisense; GATGGCGATGGTCTGCTCATAACCG
>probe:Drosophila_2:1641341_at:208:619; Interrogation_Position=2236; Antisense; TGCTCATAACCGACATGGACCGCTT
>probe:Drosophila_2:1641341_at:133:721; Interrogation_Position=2259; Antisense; TTCCTCATACCAAATGCGGCCGAAG
>probe:Drosophila_2:1641341_at:687:361; Interrogation_Position=2280; Antisense; GAAGTTACGGCACTGATTTCAAGGC
>probe:Drosophila_2:1641341_at:56:19; Interrogation_Position=2295; Antisense; ATTTCAAGGCTCATCGTGCAGGTGC
>probe:Drosophila_2:1641341_at:231:619; Interrogation_Position=2311; Antisense; TGCAGGTGCTTGACGACGCCAAGTA
>probe:Drosophila_2:1641341_at:99:315; Interrogation_Position=2375; Antisense; GCCTTTCCGCATCAAGCTTTATTTC
>probe:Drosophila_2:1641341_at:248:341; Interrogation_Position=2390; Antisense; GCTTTATTTCATGAACGGCCACTGA
>probe:Drosophila_2:1641341_at:214:159; Interrogation_Position=2431; Antisense; ACAAAGTGCAATGCGCCGCTGCGAG
>probe:Drosophila_2:1641341_at:565:729; Interrogation_Position=2474; Antisense; TTGGCATTGTTTTCCTTGTATTAGC
>probe:Drosophila_2:1641341_at:690:247; Interrogation_Position=2540; Antisense; AATTGTAACATAGTGCACTCGGTGC
>probe:Drosophila_2:1641341_at:584:85; Interrogation_Position=2587; Antisense; AGTCGAACGTAGTCCCAGATCACAT
>probe:Drosophila_2:1641341_at:261:379; Interrogation_Position=2684; Antisense; GAAGCCCTGAGACTTACAACGTGTA

Paste this into a BLAST search page for me
TCAAGTACGGATTCCCCGATGGCGAGATGGCGATGGTCTGCTCATAACCGTGCTCATAACCGACATGGACCGCTTTTCCTCATACCAAATGCGGCCGAAGGAAGTTACGGCACTGATTTCAAGGCATTTCAAGGCTCATCGTGCAGGTGCTGCAGGTGCTTGACGACGCCAAGTAGCCTTTCCGCATCAAGCTTTATTTCGCTTTATTTCATGAACGGCCACTGAACAAAGTGCAATGCGCCGCTGCGAGTTGGCATTGTTTTCCTTGTATTAGCAATTGTAACATAGTGCACTCGGTGCAGTCGAACGTAGTCCCAGATCACATGAAGCCCTGAGACTTACAACGTGTA

Full Affymetrix probeset data:

Annotations for 1641341_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720