Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641342_at:

>probe:Drosophila_2:1641342_at:486:275; Interrogation_Position=1005; Antisense; CTTCCTACCAGCAGTTGATCAGTCT
>probe:Drosophila_2:1641342_at:193:709; Interrogation_Position=1062; Antisense; TTAAGAAGGAGCTTCCCTGACCCAA
>probe:Drosophila_2:1641342_at:311:719; Interrogation_Position=1074; Antisense; TTCCCTGACCCAAGCATGCAATTTA
>probe:Drosophila_2:1641342_at:78:209; Interrogation_Position=1181; Antisense; AAGATAACTTATCCCTTCTACGCGT
>probe:Drosophila_2:1641342_at:226:531; Interrogation_Position=1228; Antisense; GGGTTATTCTATTCATGACGATGCT
>probe:Drosophila_2:1641342_at:556:519; Interrogation_Position=743; Antisense; GTGGAGCTGGGCCACTCCAATTTCT
>probe:Drosophila_2:1641342_at:343:627; Interrogation_Position=769; Antisense; TGCCTCCTCCGGATGGCTGGAGAAA
>probe:Drosophila_2:1641342_at:91:569; Interrogation_Position=795; Antisense; GGCGAAAGCGACACAACGTCCGATA
>probe:Drosophila_2:1641342_at:287:55; Interrogation_Position=822; Antisense; ATGACACCGGTGACAGCCTGGATCT
>probe:Drosophila_2:1641342_at:214:533; Interrogation_Position=868; Antisense; GGTGAAAAGCGAACCCATCTCGAAT
>probe:Drosophila_2:1641342_at:515:407; Interrogation_Position=896; Antisense; GACGATTGTGATGAGCCATACCCCG
>probe:Drosophila_2:1641342_at:490:27; Interrogation_Position=913; Antisense; ATACCCCGTGACTCTGATAGAGCCT
>probe:Drosophila_2:1641342_at:387:677; Interrogation_Position=930; Antisense; TAGAGCCTATCTATTCCACCGAGGA
>probe:Drosophila_2:1641342_at:665:223; Interrogation_Position=992; Antisense; AAGGATGACTATGCTTCCTACCAGC

Paste this into a BLAST search page for me
CTTCCTACCAGCAGTTGATCAGTCTTTAAGAAGGAGCTTCCCTGACCCAATTCCCTGACCCAAGCATGCAATTTAAAGATAACTTATCCCTTCTACGCGTGGGTTATTCTATTCATGACGATGCTGTGGAGCTGGGCCACTCCAATTTCTTGCCTCCTCCGGATGGCTGGAGAAAGGCGAAAGCGACACAACGTCCGATAATGACACCGGTGACAGCCTGGATCTGGTGAAAAGCGAACCCATCTCGAATGACGATTGTGATGAGCCATACCCCGATACCCCGTGACTCTGATAGAGCCTTAGAGCCTATCTATTCCACCGAGGAAAGGATGACTATGCTTCCTACCAGC

Full Affymetrix probeset data:

Annotations for 1641342_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime