FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641343_at:

>probe:Drosophila_2:1641343_at:216:565; Interrogation_Position=103; Antisense; GGCAAGAGGTCCTTTAACGCCGCAT
>probe:Drosophila_2:1641343_at:389:123; Interrogation_Position=163; Antisense; AGCGAGCTGGGACTCACGGATCTCT
>probe:Drosophila_2:1641343_at:282:259; Interrogation_Position=177; Antisense; CACGGATCTCTACGATTTGCAGGAT
>probe:Drosophila_2:1641343_at:510:449; Interrogation_Position=211; Antisense; GATCGTAGGCTCGAGCGCTGTCTAT
>probe:Drosophila_2:1641343_at:546:683; Interrogation_Position=233; Antisense; TATCGCAGCTCCAACGTTCACTGAT
>probe:Drosophila_2:1641343_at:126:605; Interrogation_Position=254; Antisense; TGATTGCCAGAAACTGTGTCCCCGG
>probe:Drosophila_2:1641343_at:341:557; Interrogation_Position=282; Antisense; GGACTTCAATGCCAACCGAGTAGAT
>probe:Drosophila_2:1641343_at:230:431; Interrogation_Position=299; Antisense; GAGTAGATCCGGATCCCGAAAACAG
>probe:Drosophila_2:1641343_at:4:371; Interrogation_Position=357; Antisense; GAATGTTTTGTACTCAAGTGCCAAT
>probe:Drosophila_2:1641343_at:695:219; Interrogation_Position=372; Antisense; AAGTGCCAATATCCCCAACAGACAT
>probe:Drosophila_2:1641343_at:6:315; Interrogation_Position=398; Antisense; GCCAGTCCAACGAACTCCTAGAAGA
>probe:Drosophila_2:1641343_at:204:45; Interrogation_Position=444; Antisense; ATCCGCCGAACCCAATGTGTTTGGA
>probe:Drosophila_2:1641343_at:488:13; Interrogation_Position=473; Antisense; ATTAGCCACTATCCGTTCAATGTGA
>probe:Drosophila_2:1641343_at:246:89; Interrogation_Position=80; Antisense; AGTACTCCCGCGGATGGACCAACGG

Paste this into a BLAST search page for me
GGCAAGAGGTCCTTTAACGCCGCATAGCGAGCTGGGACTCACGGATCTCTCACGGATCTCTACGATTTGCAGGATGATCGTAGGCTCGAGCGCTGTCTATTATCGCAGCTCCAACGTTCACTGATTGATTGCCAGAAACTGTGTCCCCGGGGACTTCAATGCCAACCGAGTAGATGAGTAGATCCGGATCCCGAAAACAGGAATGTTTTGTACTCAAGTGCCAATAAGTGCCAATATCCCCAACAGACATGCCAGTCCAACGAACTCCTAGAAGAATCCGCCGAACCCAATGTGTTTGGAATTAGCCACTATCCGTTCAATGTGAAGTACTCCCGCGGATGGACCAACGG

Full Affymetrix probeset data:

Annotations for 1641343_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720