FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641345_at:

>probe:Drosophila_2:1641345_at:708:637; Interrogation_Position=1941; Antisense; TAACGTGACGTGTTTGTTGCCGGGT
>probe:Drosophila_2:1641345_at:2:603; Interrogation_Position=1955; Antisense; TGTTGCCGGGTCAGTTGCGATTCGC
>probe:Drosophila_2:1641345_at:316:623; Interrogation_Position=1970; Antisense; TGCGATTCGCTGAGACACCCAATAT
>probe:Drosophila_2:1641345_at:674:241; Interrogation_Position=1990; Antisense; AATATGTCTCAGTACCTCCTATCTG
>probe:Drosophila_2:1641345_at:37:91; Interrogation_Position=2000; Antisense; AGTACCTCCTATCTGCCGCGATGCT
>probe:Drosophila_2:1641345_at:364:327; Interrogation_Position=2017; Antisense; GCGATGCTGCCCTCTATCATTGTCT
>probe:Drosophila_2:1641345_at:399:307; Interrogation_Position=2027; Antisense; CCTCTATCATTGTCTCTCTTTGTGG
>probe:Drosophila_2:1641345_at:527:643; Interrogation_Position=2041; Antisense; TCTCTTTGTGGCGACTGCTCTACGA
>probe:Drosophila_2:1641345_at:331:403; Interrogation_Position=2053; Antisense; GACTGCTCTACGACTTTTATTGTTT
>probe:Drosophila_2:1641345_at:367:711; Interrogation_Position=2087; Antisense; TTAATTGTATTTACGCTGTGCGACG
>probe:Drosophila_2:1641345_at:162:37; Interrogation_Position=2394; Antisense; ATCATGTCCGACCAGGTACCAGTTA
>probe:Drosophila_2:1641345_at:524:411; Interrogation_Position=2403; Antisense; GACCAGGTACCAGTTAACGATTATT
>probe:Drosophila_2:1641345_at:440:197; Interrogation_Position=2418; Antisense; AACGATTATTTCATAGTCTAAACAT
>probe:Drosophila_2:1641345_at:718:441; Interrogation_Position=2482; Antisense; GATGTTGACGTTGATATTGATCTAT

Paste this into a BLAST search page for me
TAACGTGACGTGTTTGTTGCCGGGTTGTTGCCGGGTCAGTTGCGATTCGCTGCGATTCGCTGAGACACCCAATATAATATGTCTCAGTACCTCCTATCTGAGTACCTCCTATCTGCCGCGATGCTGCGATGCTGCCCTCTATCATTGTCTCCTCTATCATTGTCTCTCTTTGTGGTCTCTTTGTGGCGACTGCTCTACGAGACTGCTCTACGACTTTTATTGTTTTTAATTGTATTTACGCTGTGCGACGATCATGTCCGACCAGGTACCAGTTAGACCAGGTACCAGTTAACGATTATTAACGATTATTTCATAGTCTAAACATGATGTTGACGTTGATATTGATCTAT

Full Affymetrix probeset data:

Annotations for 1641345_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720