FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641346_at:

>probe:Drosophila_2:1641346_at:539:551; Interrogation_Position=5421; Antisense; GGAGACACCGGAGAACTCTGCGCAG
>probe:Drosophila_2:1641346_at:106:119; Interrogation_Position=5453; Antisense; AGCTGCAGAGCGAGAACCACATCGT
>probe:Drosophila_2:1641346_at:557:427; Interrogation_Position=5479; Antisense; GAGTTCGAGGACATCGAGTCGATAC
>probe:Drosophila_2:1641346_at:41:433; Interrogation_Position=5494; Antisense; GAGTCGATACTCTCACATCTGCACG
>probe:Drosophila_2:1641346_at:73:129; Interrogation_Position=5521; Antisense; ACCTGATTCCAGCTCCATTGAAGTT
>probe:Drosophila_2:1641346_at:150:477; Interrogation_Position=5546; Antisense; GTTATCGTTTACATACTACATCTAG
>probe:Drosophila_2:1641346_at:683:379; Interrogation_Position=5570; Antisense; GAACCATTTGTTGGCATCTCTAAGT
>probe:Drosophila_2:1641346_at:204:365; Interrogation_Position=5622; Antisense; GAATTTAATTACTATGTGCACCAAG
>probe:Drosophila_2:1641346_at:682:505; Interrogation_Position=5637; Antisense; GTGCACCAAGGATCGTTATTATTAA
>probe:Drosophila_2:1641346_at:686:207; Interrogation_Position=5684; Antisense; AAGCTAAGACGGAGCAGCACCACCT
>probe:Drosophila_2:1641346_at:628:129; Interrogation_Position=5705; Antisense; ACCTGCTCACACAACATTCACATGA
>probe:Drosophila_2:1641346_at:274:697; Interrogation_Position=5894; Antisense; TTTCGTATTACTAAGGCCCTGCCCG
>probe:Drosophila_2:1641346_at:537:69; Interrogation_Position=5907; Antisense; AGGCCCTGCCCGAACAAAAGATTAT
>probe:Drosophila_2:1641346_at:71:457; Interrogation_Position=5937; Antisense; GATACTTTGTACTTTGTCGCATAAA

Paste this into a BLAST search page for me
GGAGACACCGGAGAACTCTGCGCAGAGCTGCAGAGCGAGAACCACATCGTGAGTTCGAGGACATCGAGTCGATACGAGTCGATACTCTCACATCTGCACGACCTGATTCCAGCTCCATTGAAGTTGTTATCGTTTACATACTACATCTAGGAACCATTTGTTGGCATCTCTAAGTGAATTTAATTACTATGTGCACCAAGGTGCACCAAGGATCGTTATTATTAAAAGCTAAGACGGAGCAGCACCACCTACCTGCTCACACAACATTCACATGATTTCGTATTACTAAGGCCCTGCCCGAGGCCCTGCCCGAACAAAAGATTATGATACTTTGTACTTTGTCGCATAAA

Full Affymetrix probeset data:

Annotations for 1641346_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720