Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641348_at:

>probe:Drosophila_2:1641348_at:708:389; Interrogation_Position=1144; Antisense; GAAAGTCTGGTTTTAGATCTAGAAC
>probe:Drosophila_2:1641348_at:432:385; Interrogation_Position=1165; Antisense; GAACATTGCGTTATGCATCGTGAAC
>probe:Drosophila_2:1641348_at:16:537; Interrogation_Position=1209; Antisense; GGTCAAGGAGCATTTACAAGCCAAA
>probe:Drosophila_2:1641348_at:596:239; Interrogation_Position=1249; Antisense; AATACTTCTCAAATTCAGGTTAGGC
>probe:Drosophila_2:1641348_at:424:267; Interrogation_Position=1264; Antisense; CAGGTTAGGCTTGATGAAGTTCACA
>probe:Drosophila_2:1641348_at:481:381; Interrogation_Position=1363; Antisense; GAACGCATGATTTATATGCTCCGTA
>probe:Drosophila_2:1641348_at:723:51; Interrogation_Position=1378; Antisense; ATGCTCCGTAGAATTCAGTCAGATC
>probe:Drosophila_2:1641348_at:125:197; Interrogation_Position=1405; Antisense; AACGATATCATTAAGGAGGACGCCA
>probe:Drosophila_2:1641348_at:407:435; Interrogation_Position=1420; Antisense; GAGGACGCCAATATTCAGGATCGAA
>probe:Drosophila_2:1641348_at:475:703; Interrogation_Position=1459; Antisense; TTAGCTAAGCATGCCAACTTGGAAC
>probe:Drosophila_2:1641348_at:545:493; Interrogation_Position=1549; Antisense; GTAATACTCCGTTCAGAGTTGACAG
>probe:Drosophila_2:1641348_at:116:401; Interrogation_Position=1569; Antisense; GACAGTTCAACAGCTATCTCAAAAG
>probe:Drosophila_2:1641348_at:262:453; Interrogation_Position=1612; Antisense; GATCTCACAGAAATAGCGAAGGCTC
>probe:Drosophila_2:1641348_at:315:325; Interrogation_Position=1627; Antisense; GCGAAGGCTCTTTTACTAGACTATC

Paste this into a BLAST search page for me
GAAAGTCTGGTTTTAGATCTAGAACGAACATTGCGTTATGCATCGTGAACGGTCAAGGAGCATTTACAAGCCAAAAATACTTCTCAAATTCAGGTTAGGCCAGGTTAGGCTTGATGAAGTTCACAGAACGCATGATTTATATGCTCCGTAATGCTCCGTAGAATTCAGTCAGATCAACGATATCATTAAGGAGGACGCCAGAGGACGCCAATATTCAGGATCGAATTAGCTAAGCATGCCAACTTGGAACGTAATACTCCGTTCAGAGTTGACAGGACAGTTCAACAGCTATCTCAAAAGGATCTCACAGAAATAGCGAAGGCTCGCGAAGGCTCTTTTACTAGACTATC

Full Affymetrix probeset data:

Annotations for 1641348_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime