FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641349_at:

>probe:Drosophila_2:1641349_at:16:563; Interrogation_Position=5069; Antisense; GGAAGAGCCCTATACTGGAGCAAAC
>probe:Drosophila_2:1641349_at:48:589; Interrogation_Position=5084; Antisense; TGGAGCAAACTTCCGATGCCATACT
>probe:Drosophila_2:1641349_at:210:49; Interrogation_Position=5099; Antisense; ATGCCATACTACTAGCAGCCCAGAG
>probe:Drosophila_2:1641349_at:536:119; Interrogation_Position=5122; Antisense; AGCGGCGATCTCAATATGTTACGTG
>probe:Drosophila_2:1641349_at:107:183; Interrogation_Position=5186; Antisense; AAAACGGACAGACGGCGCTGCATTT
>probe:Drosophila_2:1641349_at:72:19; Interrogation_Position=5207; Antisense; ATTTCGCCTGCAAATACAACCACAG
>probe:Drosophila_2:1641349_at:22:495; Interrogation_Position=5239; Antisense; GTCAAATATATCATCGCAAGCGCCA
>probe:Drosophila_2:1641349_at:330:75; Interrogation_Position=5291; Antisense; AGGAGCTTGGACAGACGGCGCTTCA
>probe:Drosophila_2:1641349_at:692:109; Interrogation_Position=5330; Antisense; AGAATCGCCGCGACATCTGCGTGAT
>probe:Drosophila_2:1641349_at:439:455; Interrogation_Position=5380; Antisense; GATACCCTAGACTCCGGCGGAAATA
>probe:Drosophila_2:1641349_at:468:381; Interrogation_Position=5430; Antisense; GAACGCCAACGAGATAGCCACCTAT
>probe:Drosophila_2:1641349_at:3:143; Interrogation_Position=5486; Antisense; ACGGCTGGCTCGACGACTAGACGAA
>probe:Drosophila_2:1641349_at:439:453; Interrogation_Position=5516; Antisense; GATCATCTCACAAAATGCCGCAGTT
>probe:Drosophila_2:1641349_at:412:93; Interrogation_Position=5537; Antisense; AGTTCCCCGCCAAGTAGAGCAATCG

Paste this into a BLAST search page for me
GGAAGAGCCCTATACTGGAGCAAACTGGAGCAAACTTCCGATGCCATACTATGCCATACTACTAGCAGCCCAGAGAGCGGCGATCTCAATATGTTACGTGAAAACGGACAGACGGCGCTGCATTTATTTCGCCTGCAAATACAACCACAGGTCAAATATATCATCGCAAGCGCCAAGGAGCTTGGACAGACGGCGCTTCAAGAATCGCCGCGACATCTGCGTGATGATACCCTAGACTCCGGCGGAAATAGAACGCCAACGAGATAGCCACCTATACGGCTGGCTCGACGACTAGACGAAGATCATCTCACAAAATGCCGCAGTTAGTTCCCCGCCAAGTAGAGCAATCG

Full Affymetrix probeset data:

Annotations for 1641349_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720