FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641350_at:

>probe:Drosophila_2:1641350_at:501:85; Interrogation_Position=1028; Antisense; AGTGCCCGTGATGCCATTAACTTAA
>probe:Drosophila_2:1641350_at:387:471; Interrogation_Position=1098; Antisense; GTTCGCGTCTAGCTGCGCAGTTTAA
>probe:Drosophila_2:1641350_at:276:349; Interrogation_Position=1114; Antisense; GCAGTTTAATCTTTCGCACACCGTC
>probe:Drosophila_2:1641350_at:232:135; Interrogation_Position=1168; Antisense; ACGCCCTCAGTACTCAACTAGTAAT
>probe:Drosophila_2:1641350_at:361:189; Interrogation_Position=1183; Antisense; AACTAGTAATTTCATCCTGGTGTCC
>probe:Drosophila_2:1641350_at:272:119; Interrogation_Position=1224; Antisense; AGCTGAGCGACGACAATTCCACCAT
>probe:Drosophila_2:1641350_at:441:53; Interrogation_Position=1280; Antisense; ATGCAGCGCCTCAAGTAACTAACTA
>probe:Drosophila_2:1641350_at:730:217; Interrogation_Position=1311; Antisense; AAGTACGCGTATATGTGCTCTCAGC
>probe:Drosophila_2:1641350_at:279:523; Interrogation_Position=1395; Antisense; GGGCCGATCCGATGCCTATAATTAT
>probe:Drosophila_2:1641350_at:404:437; Interrogation_Position=887; Antisense; GAGGACTTCAAACGTCAGCCAGTTC
>probe:Drosophila_2:1641350_at:340:123; Interrogation_Position=903; Antisense; AGCCAGTTCCGCAGACTTTTAAGGG
>probe:Drosophila_2:1641350_at:351:109; Interrogation_Position=936; Antisense; AGAAGCTGGGCAGTCCCGTGGCCAA
>probe:Drosophila_2:1641350_at:389:379; Interrogation_Position=971; Antisense; GAAGCGCCAACAGTTCCAGTGGCAT
>probe:Drosophila_2:1641350_at:333:3; Interrogation_Position=994; Antisense; ATTGTCGCCCGGTGAGGCTGCAAAC

Paste this into a BLAST search page for me
AGTGCCCGTGATGCCATTAACTTAAGTTCGCGTCTAGCTGCGCAGTTTAAGCAGTTTAATCTTTCGCACACCGTCACGCCCTCAGTACTCAACTAGTAATAACTAGTAATTTCATCCTGGTGTCCAGCTGAGCGACGACAATTCCACCATATGCAGCGCCTCAAGTAACTAACTAAAGTACGCGTATATGTGCTCTCAGCGGGCCGATCCGATGCCTATAATTATGAGGACTTCAAACGTCAGCCAGTTCAGCCAGTTCCGCAGACTTTTAAGGGAGAAGCTGGGCAGTCCCGTGGCCAAGAAGCGCCAACAGTTCCAGTGGCATATTGTCGCCCGGTGAGGCTGCAAAC

Full Affymetrix probeset data:

Annotations for 1641350_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720