FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641352_at:

>probe:Drosophila_2:1641352_at:377:13; Interrogation_Position=3682; Antisense; ATTCAGTAGGTCTTAATTCGCCGGA
>probe:Drosophila_2:1641352_at:462:375; Interrogation_Position=3713; Antisense; GAAACGTACCAATCCTTCTATCCAG
>probe:Drosophila_2:1641352_at:77:501; Interrogation_Position=3784; Antisense; GTCGTGGTCGTCTTGCTAAAGCTGC
>probe:Drosophila_2:1641352_at:436:207; Interrogation_Position=3802; Antisense; AAGCTGCGGAGAATCTTCACCGTAT
>probe:Drosophila_2:1641352_at:399:331; Interrogation_Position=3884; Antisense; GCGGCGTCCATCCAAACGAAAGATT
>probe:Drosophila_2:1641352_at:529:379; Interrogation_Position=3938; Antisense; GAAGCCACAGATTGCGGAAACCCAA
>probe:Drosophila_2:1641352_at:5:201; Interrogation_Position=3956; Antisense; AACCCAAGTGGATTGCGAGTCCGAT
>probe:Drosophila_2:1641352_at:644:363; Interrogation_Position=3991; Antisense; GAATTCTTGACACGCAAATGCCTGA
>probe:Drosophila_2:1641352_at:241:167; Interrogation_Position=4006; Antisense; AAATGCCTGATCCTCGTAAGACTCC
>probe:Drosophila_2:1641352_at:124:493; Interrogation_Position=4021; Antisense; GTAAGACTCCAACGAGACCTCGACA
>probe:Drosophila_2:1641352_at:47:529; Interrogation_Position=4117; Antisense; GGGAGACTACCATAGGCACATATCT
>probe:Drosophila_2:1641352_at:398:225; Interrogation_Position=4143; Antisense; AAGGACTCCATGATCGTTTCAAGCG
>probe:Drosophila_2:1641352_at:711:255; Interrogation_Position=4189; Antisense; CAAACACTCATGCTATTTACCTTCG
>probe:Drosophila_2:1641352_at:26:279; Interrogation_Position=4201; Antisense; CTATTTACCTTCGTGCACTCAAGTA

Paste this into a BLAST search page for me
ATTCAGTAGGTCTTAATTCGCCGGAGAAACGTACCAATCCTTCTATCCAGGTCGTGGTCGTCTTGCTAAAGCTGCAAGCTGCGGAGAATCTTCACCGTATGCGGCGTCCATCCAAACGAAAGATTGAAGCCACAGATTGCGGAAACCCAAAACCCAAGTGGATTGCGAGTCCGATGAATTCTTGACACGCAAATGCCTGAAAATGCCTGATCCTCGTAAGACTCCGTAAGACTCCAACGAGACCTCGACAGGGAGACTACCATAGGCACATATCTAAGGACTCCATGATCGTTTCAAGCGCAAACACTCATGCTATTTACCTTCGCTATTTACCTTCGTGCACTCAAGTA

Full Affymetrix probeset data:

Annotations for 1641352_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720