Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641355_a_at:

>probe:Drosophila_2:1641355_a_at:261:361; Interrogation_Position=428; Antisense; GCAAGCGCGTCGTCCTGTTGAAGGT
>probe:Drosophila_2:1641355_a_at:155:603; Interrogation_Position=443; Antisense; TGTTGAAGGTCTTGGCCTCCGGACT
>probe:Drosophila_2:1641355_a_at:714:515; Interrogation_Position=517; Antisense; GTGTCCCAGCGCTACGTGATCGGCA
>probe:Drosophila_2:1641355_a_at:551:449; Interrogation_Position=534; Antisense; GATCGGCACCTCCTCGAAGGTGGAT
>probe:Drosophila_2:1641355_a_at:511:519; Interrogation_Position=553; Antisense; GTGGATCTCGGTGCCTTCAAGGTGC
>probe:Drosophila_2:1641355_a_at:279:11; Interrogation_Position=599; Antisense; ACTTCCGCCGTCTGAAGGCTAAGAA
>probe:Drosophila_2:1641355_a_at:121:111; Interrogation_Position=662; Antisense; AGAAGGAGCGCTTCGTGCCCAACGA
>probe:Drosophila_2:1641355_a_at:409:615; Interrogation_Position=728; Antisense; TGAAGGTCATCAAGGCCCATCCCGA
>probe:Drosophila_2:1641355_a_at:149:433; Interrogation_Position=751; Antisense; GAGGGCAAGTTCTTCGCCAAGTACT
>probe:Drosophila_2:1641355_a_at:91:489; Interrogation_Position=771; Antisense; GTACTTGCAGAACATGTTTGCCCTG
>probe:Drosophila_2:1641355_a_at:599:547; Interrogation_Position=838; Antisense; GGATGGATTTGGTTCTTCAGTTTAA
>probe:Drosophila_2:1641355_a_at:413:181; Interrogation_Position=876; Antisense; AAAAACACTGTACAAGCGCGCCCGC
>probe:Drosophila_2:1641355_a_at:648:321; Interrogation_Position=891; Antisense; GCGCGCCCGCTGGTTAGACTAACAG
>probe:Drosophila_2:1641355_a_at:291:393; Interrogation_Position=943; Antisense; GAAAGTTTTGGCCTTTTCATCAAAG

Paste this into a BLAST search page for me
GCAAGCGCGTCGTCCTGTTGAAGGTTGTTGAAGGTCTTGGCCTCCGGACTGTGTCCCAGCGCTACGTGATCGGCAGATCGGCACCTCCTCGAAGGTGGATGTGGATCTCGGTGCCTTCAAGGTGCACTTCCGCCGTCTGAAGGCTAAGAAAGAAGGAGCGCTTCGTGCCCAACGATGAAGGTCATCAAGGCCCATCCCGAGAGGGCAAGTTCTTCGCCAAGTACTGTACTTGCAGAACATGTTTGCCCTGGGATGGATTTGGTTCTTCAGTTTAAAAAAACACTGTACAAGCGCGCCCGCGCGCGCCCGCTGGTTAGACTAACAGGAAAGTTTTGGCCTTTTCATCAAAG

Full Affymetrix probeset data:

Annotations for 1641355_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime