FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641356_at:

>probe:Drosophila_2:1641356_at:629:661; Interrogation_Position=4782; Antisense; TACTCGCAAGACATCTACCACAAAG
>probe:Drosophila_2:1641356_at:489:101; Interrogation_Position=4813; Antisense; AGAGAGCCAACCACTCGGGAGACAA
>probe:Drosophila_2:1641356_at:7:259; Interrogation_Position=4824; Antisense; CACTCGGGAGACAAGCACATCGGTT
>probe:Drosophila_2:1641356_at:81:381; Interrogation_Position=4909; Antisense; GAACCAACATCCGTAGAAACTACTA
>probe:Drosophila_2:1641356_at:587:365; Interrogation_Position=4944; Antisense; GAATCAGAGCAATACGACCACGGAA
>probe:Drosophila_2:1641356_at:156:565; Interrogation_Position=4965; Antisense; GGAATCAACCACCACCGAAGAGCAA
>probe:Drosophila_2:1641356_at:376:373; Interrogation_Position=4981; Antisense; GAAGAGCAACATGTTCACCACCATC
>probe:Drosophila_2:1641356_at:399:261; Interrogation_Position=4999; Antisense; CACCATCATCACCATATTCATTATC
>probe:Drosophila_2:1641356_at:66:715; Interrogation_Position=5015; Antisense; TTCATTATCACAAACCCGCTGATCT
>probe:Drosophila_2:1641356_at:690:603; Interrogation_Position=5034; Antisense; TGATCTCGGTCCATCAATTCTTCCA
>probe:Drosophila_2:1641356_at:397:693; Interrogation_Position=5130; Antisense; TTTGCCTCCTTTACCAACAGCGTTG
>probe:Drosophila_2:1641356_at:221:687; Interrogation_Position=5178; Antisense; TTTGCCACCTTTGCCGGAAGTAAAT
>probe:Drosophila_2:1641356_at:347:709; Interrogation_Position=5203; Antisense; TTAACAGCAATATCCTTACCAGAAA
>probe:Drosophila_2:1641356_at:330:259; Interrogation_Position=5249; Antisense; CACTACCACAATTGCCGAATCCTTT

Paste this into a BLAST search page for me
TACTCGCAAGACATCTACCACAAAGAGAGAGCCAACCACTCGGGAGACAACACTCGGGAGACAAGCACATCGGTTGAACCAACATCCGTAGAAACTACTAGAATCAGAGCAATACGACCACGGAAGGAATCAACCACCACCGAAGAGCAAGAAGAGCAACATGTTCACCACCATCCACCATCATCACCATATTCATTATCTTCATTATCACAAACCCGCTGATCTTGATCTCGGTCCATCAATTCTTCCATTTGCCTCCTTTACCAACAGCGTTGTTTGCCACCTTTGCCGGAAGTAAATTTAACAGCAATATCCTTACCAGAAACACTACCACAATTGCCGAATCCTTT

Full Affymetrix probeset data:

Annotations for 1641356_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720