FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641357_at:

>probe:Drosophila_2:1641357_at:502:541; Interrogation_Position=1003; Antisense; GGTTCAGTCCCGAGGCAATTTATGC
>probe:Drosophila_2:1641357_at:694:371; Interrogation_Position=1067; Antisense; GAAGGTCACCGTGGAACTGGCCCCA
>probe:Drosophila_2:1641357_at:682:441; Interrogation_Position=1128; Antisense; GATGTGGGAGCTCTTTACAACGAAC
>probe:Drosophila_2:1641357_at:394:155; Interrogation_Position=1151; Antisense; ACAGCTCGTATCTATGGACGTCCAT
>probe:Drosophila_2:1641357_at:1:79; Interrogation_Position=1192; Antisense; AGGATGCCGGTGGATTTATCGCCAT
>probe:Drosophila_2:1641357_at:449:703; Interrogation_Position=1207; Antisense; TTATCGCCATCAATGCGGTCCGAAT
>probe:Drosophila_2:1641357_at:171:287; Interrogation_Position=1253; Antisense; CGGTGCCTACGATGTGCCAACGAAG
>probe:Drosophila_2:1641357_at:588:535; Interrogation_Position=752; Antisense; GGTCTACACTAAACCCCTGGAGATG
>probe:Drosophila_2:1641357_at:517:31; Interrogation_Position=790; Antisense; ATAAGCTTGGCGGATCATATGGCAT
>probe:Drosophila_2:1641357_at:138:151; Interrogation_Position=836; Antisense; AAATCGCTTTGTGGGACTGAAGTCC
>probe:Drosophila_2:1641357_at:103:547; Interrogation_Position=911; Antisense; GGACCTCGAGGTGTTTGCTTTGGAC
>probe:Drosophila_2:1641357_at:339:253; Interrogation_Position=953; Antisense; CAAGCAGGTTCTCCGGGATCGCATG
>probe:Drosophila_2:1641357_at:589:635; Interrogation_Position=971; Antisense; TCGCATGGCCGACTACGTGTACAAT
>probe:Drosophila_2:1641357_at:259:515; Interrogation_Position=987; Antisense; GTGTACAATGGCTTCTGGTTCAGTC

Paste this into a BLAST search page for me
GGTTCAGTCCCGAGGCAATTTATGCGAAGGTCACCGTGGAACTGGCCCCAGATGTGGGAGCTCTTTACAACGAACACAGCTCGTATCTATGGACGTCCATAGGATGCCGGTGGATTTATCGCCATTTATCGCCATCAATGCGGTCCGAATCGGTGCCTACGATGTGCCAACGAAGGGTCTACACTAAACCCCTGGAGATGATAAGCTTGGCGGATCATATGGCATAAATCGCTTTGTGGGACTGAAGTCCGGACCTCGAGGTGTTTGCTTTGGACCAAGCAGGTTCTCCGGGATCGCATGTCGCATGGCCGACTACGTGTACAATGTGTACAATGGCTTCTGGTTCAGTC

Full Affymetrix probeset data:

Annotations for 1641357_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720