Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641358_s_at:

>probe:Drosophila_2:1641358_s_at:413:623; Interrogation_Position=122; Antisense; TGCGGTCCACAACTTCTGGTCACAG
>probe:Drosophila_2:1641358_s_at:246:61; Interrogation_Position=13; Antisense; ATGTCCATGCCGGATGCCGGTTCAC
>probe:Drosophila_2:1641358_s_at:271:641; Interrogation_Position=136; Antisense; TCTGGTCACAGCACTGGCACGAATA
>probe:Drosophila_2:1641358_s_at:291:243; Interrogation_Position=157; Antisense; AATAGTACCACTGTCTGCGAATCTC
>probe:Drosophila_2:1641358_s_at:309:367; Interrogation_Position=175; Antisense; GAATCTCCCGGTGCTCGGGATCGTA
>probe:Drosophila_2:1641358_s_at:419:645; Interrogation_Position=220; Antisense; TCTTGCGTATCATCCGCCTGCTCAG
>probe:Drosophila_2:1641358_s_at:313:545; Interrogation_Position=24; Antisense; GGATGCCGGTTCACTTAAATCGCCC
>probe:Drosophila_2:1641358_s_at:66:57; Interrogation_Position=269; Antisense; ATGAGCGTGCCCTTGAGCGCTGTCT
>probe:Drosophila_2:1641358_s_at:115:633; Interrogation_Position=291; Antisense; TCTGCGTGGGACGACGGACGACCTT
>probe:Drosophila_2:1641358_s_at:231:505; Interrogation_Position=321; Antisense; GTCCGGCCTGCGGTATTCGCTGAAA
>probe:Drosophila_2:1641358_s_at:558:717; Interrogation_Position=336; Antisense; TTCGCTGAAAGGACCACCGCCGGAG
>probe:Drosophila_2:1641358_s_at:461:289; Interrogation_Position=356; Antisense; CGGAGCTCTACTCGGCCAAGAAGGA
>probe:Drosophila_2:1641358_s_at:537:557; Interrogation_Position=378; Antisense; GGACTTCATCAGCAAGGGTCCGCTG
>probe:Drosophila_2:1641358_s_at:322:75; Interrogation_Position=59; Antisense; AGGAGGTCGAGTGCCATCGCCTGCT

Paste this into a BLAST search page for me
TGCGGTCCACAACTTCTGGTCACAGATGTCCATGCCGGATGCCGGTTCACTCTGGTCACAGCACTGGCACGAATAAATAGTACCACTGTCTGCGAATCTCGAATCTCCCGGTGCTCGGGATCGTATCTTGCGTATCATCCGCCTGCTCAGGGATGCCGGTTCACTTAAATCGCCCATGAGCGTGCCCTTGAGCGCTGTCTTCTGCGTGGGACGACGGACGACCTTGTCCGGCCTGCGGTATTCGCTGAAATTCGCTGAAAGGACCACCGCCGGAGCGGAGCTCTACTCGGCCAAGAAGGAGGACTTCATCAGCAAGGGTCCGCTGAGGAGGTCGAGTGCCATCGCCTGCT

Full Affymetrix probeset data:

Annotations for 1641358_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime