FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641359_at:

>probe:Drosophila_2:1641359_at:310:311; Interrogation_Position=1055; Antisense; GGAGGCGTTTTACAAGGACACCAAG
>probe:Drosophila_2:1641359_at:659:225; Interrogation_Position=1068; Antisense; AAGGACACCAAGATTACGCTCGCCG
>probe:Drosophila_2:1641359_at:310:671; Interrogation_Position=1082; Antisense; TACGCTCGCCGATAGTCAGATGTGT
>probe:Drosophila_2:1641359_at:422:95; Interrogation_Position=1117; Antisense; AGATTGGCGTTGATTCCTGCAGTGG
>probe:Drosophila_2:1641359_at:246:575; Interrogation_Position=1149; Antisense; GGCGGACCACTGACCGTAGAGGCAA
>probe:Drosophila_2:1641359_at:445:237; Interrogation_Position=1188; Antisense; AATCGATATGTCTATCTGGCCGGCG
>probe:Drosophila_2:1641359_at:702:573; Interrogation_Position=1209; Antisense; GGCGTGGTCTCCATTGGACGGAAAC
>probe:Drosophila_2:1641359_at:491:357; Interrogation_Position=1240; Antisense; GCACAGCGTTGTTTTCCGGAATTTA
>probe:Drosophila_2:1641359_at:565:707; Interrogation_Position=1262; Antisense; TTACACCCGGGTCAGCAGCTACATG
>probe:Drosophila_2:1641359_at:116:107; Interrogation_Position=1295; Antisense; AGAAAGCACCATTCGAGCCAATCGC
>probe:Drosophila_2:1641359_at:4:17; Interrogation_Position=1320; Antisense; ATTTAAGCGACTCTCGACTTTCGTT
>probe:Drosophila_2:1641359_at:722:693; Interrogation_Position=1350; Antisense; TTTCGGCTATTTTTGGGCACCCATA
>probe:Drosophila_2:1641359_at:13:459; Interrogation_Position=843; Antisense; GATATAGCCCTGCTGCGTTTATCAC
>probe:Drosophila_2:1641359_at:665:445; Interrogation_Position=887; Antisense; GATGCAGAATCTGGAGCCCGTCTGT

Paste this into a BLAST search page for me
GGAGGCGTTTTACAAGGACACCAAGAAGGACACCAAGATTACGCTCGCCGTACGCTCGCCGATAGTCAGATGTGTAGATTGGCGTTGATTCCTGCAGTGGGGCGGACCACTGACCGTAGAGGCAAAATCGATATGTCTATCTGGCCGGCGGGCGTGGTCTCCATTGGACGGAAACGCACAGCGTTGTTTTCCGGAATTTATTACACCCGGGTCAGCAGCTACATGAGAAAGCACCATTCGAGCCAATCGCATTTAAGCGACTCTCGACTTTCGTTTTTCGGCTATTTTTGGGCACCCATAGATATAGCCCTGCTGCGTTTATCACGATGCAGAATCTGGAGCCCGTCTGT

Full Affymetrix probeset data:

Annotations for 1641359_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720