FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641360_at:

>probe:Drosophila_2:1641360_at:304:599; Interrogation_Position=371; Antisense; TGTCCCGGCCAAGTTGAGCTATATA
>probe:Drosophila_2:1641360_at:566:61; Interrogation_Position=410; Antisense; ATGGCCCGGATTTTCGAGCGTTTGG
>probe:Drosophila_2:1641360_at:339:551; Interrogation_Position=446; Antisense; TATAGCCTGGTCACCGTTAACCTTA
>probe:Drosophila_2:1641360_at:113:25; Interrogation_Position=470; Antisense; ATAGATTCCCATTACTGCTCGGAGC
>probe:Drosophila_2:1641360_at:729:415; Interrogation_Position=491; Antisense; GAGCCTGCCAAATTCATTGCCACTT
>probe:Drosophila_2:1641360_at:521:59; Interrogation_Position=536; Antisense; ATGTTGCGGATGAGTCTACCCCACG
>probe:Drosophila_2:1641360_at:34:673; Interrogation_Position=552; Antisense; TACCCCACGTTAATGTGCTTTCCAA
>probe:Drosophila_2:1641360_at:346:685; Interrogation_Position=626; Antisense; TATTATACGGACGTCCTGGACCTCA
>probe:Drosophila_2:1641360_at:492:287; Interrogation_Position=641; Antisense; CTGGACCTCAAGTATCTGCTGGACA
>probe:Drosophila_2:1641360_at:621:633; Interrogation_Position=679; Antisense; TCCCGCCATGCGCAAGTATCGAAAA
>probe:Drosophila_2:1641360_at:155:65; Interrogation_Position=725; Antisense; ATGGTGGAGGACTACGCTCTCGTTT
>probe:Drosophila_2:1641360_at:326:587; Interrogation_Position=762; Antisense; TGGACGTCTTCAGCACGGACAGCAT
>probe:Drosophila_2:1641360_at:301:551; Interrogation_Position=844; Antisense; GGAGCAGACGGTCAACTCACTACTA
>probe:Drosophila_2:1641360_at:722:549; Interrogation_Position=907; Antisense; GGAGCATGATGTCCAACCCTATATG

Paste this into a BLAST search page for me
TGTCCCGGCCAAGTTGAGCTATATAATGGCCCGGATTTTCGAGCGTTTGGTATAGCCTGGTCACCGTTAACCTTAATAGATTCCCATTACTGCTCGGAGCGAGCCTGCCAAATTCATTGCCACTTATGTTGCGGATGAGTCTACCCCACGTACCCCACGTTAATGTGCTTTCCAATATTATACGGACGTCCTGGACCTCACTGGACCTCAAGTATCTGCTGGACATCCCGCCATGCGCAAGTATCGAAAAATGGTGGAGGACTACGCTCTCGTTTTGGACGTCTTCAGCACGGACAGCATGGAGCAGACGGTCAACTCACTACTAGGAGCATGATGTCCAACCCTATATG

Full Affymetrix probeset data:

Annotations for 1641360_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720