FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641362_at:

>probe:Drosophila_2:1641362_at:623:181; Interrogation_Position=394; Antisense; AAAATAGTCGGCGTCGTCCTCAATG
>probe:Drosophila_2:1641362_at:63:229; Interrogation_Position=415; Antisense; AATGGCATCCTGAAGCCGGGCGACA
>probe:Drosophila_2:1641362_at:310:421; Interrogation_Position=453; Antisense; GAGCAAGCTGGACTGCAACGACGAT
>probe:Drosophila_2:1641362_at:50:217; Interrogation_Position=490; Antisense; AAGATTTTCGACTTGCTGCACAGGC
>probe:Drosophila_2:1641362_at:105:73; Interrogation_Position=511; Antisense; AGGCACAATCTCAAGCACAATCTCT
>probe:Drosophila_2:1641362_at:695:553; Interrogation_Position=552; Antisense; GGACTGCATGTTCGATGTGCGCATC
>probe:Drosophila_2:1641362_at:694:345; Interrogation_Position=572; Antisense; GCATCCTATCGGTGGACTCGTGCTA
>probe:Drosophila_2:1641362_at:705:107; Interrogation_Position=701; Antisense; AGAAGATCTTTCGTTCCCATGGCTT
>probe:Drosophila_2:1641362_at:634:67; Interrogation_Position=719; Antisense; ATGGCTTTGAGGTCTTCTCGGAGCA
>probe:Drosophila_2:1641362_at:510:639; Interrogation_Position=736; Antisense; TCGGAGCAACCCTACAGCAAGTATA
>probe:Drosophila_2:1641362_at:586:547; Interrogation_Position=792; Antisense; GGAGGCGCCCCACATCAAATTGCAG
>probe:Drosophila_2:1641362_at:626:615; Interrogation_Position=812; Antisense; TGCAGCAGCTCTACAAGGCGATCTG
>probe:Drosophila_2:1641362_at:264:349; Interrogation_Position=861; Antisense; GCAGTCGCTTTAAGGAGTCACCCGG
>probe:Drosophila_2:1641362_at:327:305; Interrogation_Position=882; Antisense; CCGGCTGGCTCACATTTGGAACAAT

Paste this into a BLAST search page for me
AAAATAGTCGGCGTCGTCCTCAATGAATGGCATCCTGAAGCCGGGCGACAGAGCAAGCTGGACTGCAACGACGATAAGATTTTCGACTTGCTGCACAGGCAGGCACAATCTCAAGCACAATCTCTGGACTGCATGTTCGATGTGCGCATCGCATCCTATCGGTGGACTCGTGCTAAGAAGATCTTTCGTTCCCATGGCTTATGGCTTTGAGGTCTTCTCGGAGCATCGGAGCAACCCTACAGCAAGTATAGGAGGCGCCCCACATCAAATTGCAGTGCAGCAGCTCTACAAGGCGATCTGGCAGTCGCTTTAAGGAGTCACCCGGCCGGCTGGCTCACATTTGGAACAAT

Full Affymetrix probeset data:

Annotations for 1641362_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720