FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641363_at:

>probe:Drosophila_2:1641363_at:398:119; Interrogation_Position=1032; Antisense; AGCGGCCGGACTTCAATCAGTACTA
>probe:Drosophila_2:1641363_at:697:425; Interrogation_Position=1064; Antisense; GAGATCGCCGAAATCGAGGACCGCC
>probe:Drosophila_2:1641363_at:290:437; Interrogation_Position=1079; Antisense; GAGGACCGCCTGGTCAAGGGAACCT
>probe:Drosophila_2:1641363_at:571:197; Interrogation_Position=1216; Antisense; AACGGTGCCCACTATACCGGATGAA
>probe:Drosophila_2:1641363_at:518:369; Interrogation_Position=1238; Antisense; GAAGGAAACGGTTCTCCACTGGCCA
>probe:Drosophila_2:1641363_at:554:177; Interrogation_Position=1265; Antisense; AAACAGCCGTCGATCACCGAGGGTG
>probe:Drosophila_2:1641363_at:107:717; Interrogation_Position=1306; Antisense; TTGAAGGATCCTGCGAATCGGCGCT
>probe:Drosophila_2:1641363_at:433:39; Interrogation_Position=1322; Antisense; ATCGGCGCTTGCTAGATTTCTAAAT
>probe:Drosophila_2:1641363_at:309:469; Interrogation_Position=1371; Antisense; GTTCTCAAAATTTTCAGTTCCAGCT
>probe:Drosophila_2:1641363_at:276:173; Interrogation_Position=865; Antisense; AAAGAAGCCCAAGCACGTGTGTCCA
>probe:Drosophila_2:1641363_at:66:141; Interrogation_Position=879; Antisense; ACGTGTGTCCATATTGCTGCAAGAA
>probe:Drosophila_2:1641363_at:556:219; Interrogation_Position=956; Antisense; AAGTGCCACAAGTCGCGCAAGTTCT
>probe:Drosophila_2:1641363_at:513:297; Interrogation_Position=971; Antisense; CGCAAGTTCTGCTGCTGCACCAAAA
>probe:Drosophila_2:1641363_at:52:67; Interrogation_Position=995; Antisense; ATGGACTTCAACTTGCAGTGGGTCA

Paste this into a BLAST search page for me
AGCGGCCGGACTTCAATCAGTACTAGAGATCGCCGAAATCGAGGACCGCCGAGGACCGCCTGGTCAAGGGAACCTAACGGTGCCCACTATACCGGATGAAGAAGGAAACGGTTCTCCACTGGCCAAAACAGCCGTCGATCACCGAGGGTGTTGAAGGATCCTGCGAATCGGCGCTATCGGCGCTTGCTAGATTTCTAAATGTTCTCAAAATTTTCAGTTCCAGCTAAAGAAGCCCAAGCACGTGTGTCCAACGTGTGTCCATATTGCTGCAAGAAAAGTGCCACAAGTCGCGCAAGTTCTCGCAAGTTCTGCTGCTGCACCAAAAATGGACTTCAACTTGCAGTGGGTCA

Full Affymetrix probeset data:

Annotations for 1641363_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720