FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641364_at:

>probe:Drosophila_2:1641364_at:8:383; Interrogation_Position=2616; Antisense; GAACGCGTTCATGTCAGACGATACT
>probe:Drosophila_2:1641364_at:17:705; Interrogation_Position=2657; Antisense; TTAGGCTGCGCGTACATCGCAAGCT
>probe:Drosophila_2:1641364_at:460:43; Interrogation_Position=2672; Antisense; ATCGCAAGCTGTCTGTTAGGCTCAA
>probe:Drosophila_2:1641364_at:556:183; Interrogation_Position=2696; Antisense; AAAAGAGCTTCTTCTGGCGCAGCTG
>probe:Drosophila_2:1641364_at:35:59; Interrogation_Position=2736; Antisense; ATGATTGGTCGATTGTGGCCGCCGT
>probe:Drosophila_2:1641364_at:13:115; Interrogation_Position=2762; Antisense; AGCAGCTTGTCCTCGTTTAGCAGGC
>probe:Drosophila_2:1641364_at:354:321; Interrogation_Position=2785; Antisense; GCCCGGATCCAACCCTATTTATTGA
>probe:Drosophila_2:1641364_at:200:291; Interrogation_Position=2848; Antisense; CGGTGGCCCACGACAATGACTGAGA
>probe:Drosophila_2:1641364_at:670:55; Interrogation_Position=2863; Antisense; ATGACTGAGAAACCGCGTGCATCCT
>probe:Drosophila_2:1641364_at:376:125; Interrogation_Position=2945; Antisense; AGCCCGCGATTCACTTGTGTTCGGA
>probe:Drosophila_2:1641364_at:399:729; Interrogation_Position=2959; Antisense; TTGTGTTCGGATCGAGTTCCAGTCC
>probe:Drosophila_2:1641364_at:659:503; Interrogation_Position=2980; Antisense; GTCCCCAACCGACTATATAGTGGCA
>probe:Drosophila_2:1641364_at:715:265; Interrogation_Position=3003; Antisense; CAGTATGTAACTGGCTGAGCGGACT
>probe:Drosophila_2:1641364_at:696:417; Interrogation_Position=3019; Antisense; GAGCGGACTGCATGGACTTGGCACA

Paste this into a BLAST search page for me
GAACGCGTTCATGTCAGACGATACTTTAGGCTGCGCGTACATCGCAAGCTATCGCAAGCTGTCTGTTAGGCTCAAAAAAGAGCTTCTTCTGGCGCAGCTGATGATTGGTCGATTGTGGCCGCCGTAGCAGCTTGTCCTCGTTTAGCAGGCGCCCGGATCCAACCCTATTTATTGACGGTGGCCCACGACAATGACTGAGAATGACTGAGAAACCGCGTGCATCCTAGCCCGCGATTCACTTGTGTTCGGATTGTGTTCGGATCGAGTTCCAGTCCGTCCCCAACCGACTATATAGTGGCACAGTATGTAACTGGCTGAGCGGACTGAGCGGACTGCATGGACTTGGCACA

Full Affymetrix probeset data:

Annotations for 1641364_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720