Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641368_at:

>probe:Drosophila_2:1641368_at:36:429; Interrogation_Position=1216; Antisense; GAGATTCACGATCGCAGCAAACCGC
>probe:Drosophila_2:1641368_at:370:357; Interrogation_Position=1232; Antisense; GCAAACCGCATTGCTTTGAGTTGTT
>probe:Drosophila_2:1641368_at:690:623; Interrogation_Position=1257; Antisense; TGCGACGGGCGGTGCTGATATAATC
>probe:Drosophila_2:1641368_at:118:225; Interrogation_Position=1282; Antisense; AAGGCATGCAAGACTGACTCTGAGG
>probe:Drosophila_2:1641368_at:666:433; Interrogation_Position=1318; Antisense; GAGGGCAAGCATACGGTGTACCGCA
>probe:Drosophila_2:1641368_at:243:325; Interrogation_Position=1383; Antisense; GCGTTTGACGCAGTCCATAAGCCAT
>probe:Drosophila_2:1641368_at:549:235; Interrogation_Position=1408; Antisense; AATCCGTTTTATGACATCCTGGTAC
>probe:Drosophila_2:1641368_at:66:473; Interrogation_Position=1460; Antisense; GTTAATACTAACAAGCAGCTCGGCG
>probe:Drosophila_2:1641368_at:623:117; Interrogation_Position=1476; Antisense; AGCTCGGCGAATCTTTTGTCTTGGA
>probe:Drosophila_2:1641368_at:119:453; Interrogation_Position=1499; Antisense; GATCTCAGTGAAACTCTGCTACTCG
>probe:Drosophila_2:1641368_at:484:619; Interrogation_Position=1515; Antisense; TGCTACTCGCTTGTGTTGCTCTCTA
>probe:Drosophila_2:1641368_at:521:19; Interrogation_Position=1598; Antisense; ATTTCCATGTTGAACCAATGCCTGT
>probe:Drosophila_2:1641368_at:149:655; Interrogation_Position=1622; Antisense; TAATTGTTTTACCTTCCGCATTGGC
>probe:Drosophila_2:1641368_at:239:411; Interrogation_Position=1708; Antisense; GACGCACTTTGTCTCTATTGTTGTG

Paste this into a BLAST search page for me
GAGATTCACGATCGCAGCAAACCGCGCAAACCGCATTGCTTTGAGTTGTTTGCGACGGGCGGTGCTGATATAATCAAGGCATGCAAGACTGACTCTGAGGGAGGGCAAGCATACGGTGTACCGCAGCGTTTGACGCAGTCCATAAGCCATAATCCGTTTTATGACATCCTGGTACGTTAATACTAACAAGCAGCTCGGCGAGCTCGGCGAATCTTTTGTCTTGGAGATCTCAGTGAAACTCTGCTACTCGTGCTACTCGCTTGTGTTGCTCTCTAATTTCCATGTTGAACCAATGCCTGTTAATTGTTTTACCTTCCGCATTGGCGACGCACTTTGTCTCTATTGTTGTG

Full Affymetrix probeset data:

Annotations for 1641368_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime