FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641369_at:

>probe:Drosophila_2:1641369_at:569:89; Interrogation_Position=1657; Antisense; AGTTCTAACTTGGAAACGATGCTTC
>probe:Drosophila_2:1641369_at:22:139; Interrogation_Position=1672; Antisense; ACGATGCTTCATCCTCAAAAGGCGG
>probe:Drosophila_2:1641369_at:204:473; Interrogation_Position=1776; Antisense; GTTACAAACTATCAAGAGTCCCGAA
>probe:Drosophila_2:1641369_at:695:429; Interrogation_Position=1791; Antisense; GAGTCCCGAAGACCAATTATGTAAT
>probe:Drosophila_2:1641369_at:630:393; Interrogation_Position=1819; Antisense; GAAAGTCCACTGATATCGGCCATTG
>probe:Drosophila_2:1641369_at:583:35; Interrogation_Position=1833; Antisense; ATCGGCCATTGAAACCATTGCAAAT
>probe:Drosophila_2:1641369_at:310:173; Interrogation_Position=1875; Antisense; AAACCCTGGCTACGACAATAATTCG
>probe:Drosophila_2:1641369_at:500:57; Interrogation_Position=1982; Antisense; ATGAGATACCAGATGGCCCTTTGCT
>probe:Drosophila_2:1641369_at:164:67; Interrogation_Position=1994; Antisense; ATGGCCCTTTGCTCTCATCAAAAAT
>probe:Drosophila_2:1641369_at:125:425; Interrogation_Position=2029; Antisense; GAGAGTTTACAAGGACAACCCCTAG
>probe:Drosophila_2:1641369_at:585:543; Interrogation_Position=2041; Antisense; GGACAACCCCTAGAAATTTTGAATG
>probe:Drosophila_2:1641369_at:150:243; Interrogation_Position=2088; Antisense; AATATCATCCTGTTGCAGTGCTGAA
>probe:Drosophila_2:1641369_at:352:367; Interrogation_Position=2113; Antisense; GAATCTGTAAAAATGTTTCCTTCGA
>probe:Drosophila_2:1641369_at:195:123; Interrogation_Position=2169; Antisense; AGCCGACTTGGAAGCAACATTCGTT

Paste this into a BLAST search page for me
AGTTCTAACTTGGAAACGATGCTTCACGATGCTTCATCCTCAAAAGGCGGGTTACAAACTATCAAGAGTCCCGAAGAGTCCCGAAGACCAATTATGTAATGAAAGTCCACTGATATCGGCCATTGATCGGCCATTGAAACCATTGCAAATAAACCCTGGCTACGACAATAATTCGATGAGATACCAGATGGCCCTTTGCTATGGCCCTTTGCTCTCATCAAAAATGAGAGTTTACAAGGACAACCCCTAGGGACAACCCCTAGAAATTTTGAATGAATATCATCCTGTTGCAGTGCTGAAGAATCTGTAAAAATGTTTCCTTCGAAGCCGACTTGGAAGCAACATTCGTT

Full Affymetrix probeset data:

Annotations for 1641369_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720