FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641371_at:

>probe:Drosophila_2:1641371_at:696:681; Interrogation_Position=1023; Antisense; TATGACTCTTTTAACTCTTACCCTG
>probe:Drosophila_2:1641371_at:10:717; Interrogation_Position=516; Antisense; TTCTGCTTCTCGATGTCCTGAAGAG
>probe:Drosophila_2:1641371_at:368:729; Interrogation_Position=558; Antisense; TTGTGGTCCTGTCCAGCATTGCTCA
>probe:Drosophila_2:1641371_at:359:7; Interrogation_Position=575; Antisense; ATTGCTCACCGCTTCGGAAGGATTA
>probe:Drosophila_2:1641371_at:350:393; Interrogation_Position=636; Antisense; GAAAGATGGCCTACTGTCAGAGCAA
>probe:Drosophila_2:1641371_at:544:195; Interrogation_Position=668; Antisense; AACGTCCTCTTCACCAGGGAGTTGG
>probe:Drosophila_2:1641371_at:445:233; Interrogation_Position=725; Antisense; AATGCCCTACATCCCGGAGTAGTAA
>probe:Drosophila_2:1641371_at:425:485; Interrogation_Position=759; Antisense; TGTTCCGCAATACACCCTTTTTGGG
>probe:Drosophila_2:1641371_at:507:561; Interrogation_Position=794; Antisense; GGAAAATTGCTCATAGCCCCTATTA
>probe:Drosophila_2:1641371_at:632:679; Interrogation_Position=841; Antisense; TAGGAATGGCGCACAGACGACCCTG
>probe:Drosophila_2:1641371_at:553:335; Interrogation_Position=869; Antisense; GCTGCCCTGGATCCCAGTTTGGAAA
>probe:Drosophila_2:1641371_at:626:373; Interrogation_Position=903; Antisense; GAAGATACTTCAGCGATTGCAAGCA
>probe:Drosophila_2:1641371_at:718:637; Interrogation_Position=941; Antisense; TCGGCCGCCCAGTATGACGATGATG
>probe:Drosophila_2:1641371_at:190:681; Interrogation_Position=953; Antisense; TATGACGATGATGCCCAATTCCTAT

Paste this into a BLAST search page for me
TATGACTCTTTTAACTCTTACCCTGTTCTGCTTCTCGATGTCCTGAAGAGTTGTGGTCCTGTCCAGCATTGCTCAATTGCTCACCGCTTCGGAAGGATTAGAAAGATGGCCTACTGTCAGAGCAAAACGTCCTCTTCACCAGGGAGTTGGAATGCCCTACATCCCGGAGTAGTAATGTTCCGCAATACACCCTTTTTGGGGGAAAATTGCTCATAGCCCCTATTATAGGAATGGCGCACAGACGACCCTGGCTGCCCTGGATCCCAGTTTGGAAAGAAGATACTTCAGCGATTGCAAGCATCGGCCGCCCAGTATGACGATGATGTATGACGATGATGCCCAATTCCTAT

Full Affymetrix probeset data:

Annotations for 1641371_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720