Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641372_at:

>probe:Drosophila_2:1641372_at:48:23; Interrogation_Position=1004; Antisense; ATATTTGGCCATGTCACTGTTCCAC
>probe:Drosophila_2:1641372_at:669:127; Interrogation_Position=1065; Antisense; ACCACATCCGGTTTGAGTTCATTCG
>probe:Drosophila_2:1641372_at:700:607; Interrogation_Position=1078; Antisense; TGAGTTCATTCGATTCCAACGCGTC
>probe:Drosophila_2:1641372_at:727:503; Interrogation_Position=1100; Antisense; GTCCAACCAAAGACGTTTCAATCGC
>probe:Drosophila_2:1641372_at:278:709; Interrogation_Position=1116; Antisense; TTCAATCGCAAACATTCGGCTATCG
>probe:Drosophila_2:1641372_at:366:697; Interrogation_Position=1149; Antisense; TTTCATTTTTCGTTTGTTGCATCGG
>probe:Drosophila_2:1641372_at:59:469; Interrogation_Position=1164; Antisense; GTTGCATCGGTTGCATCCAATCGAA
>probe:Drosophila_2:1641372_at:397:465; Interrogation_Position=1192; Antisense; GATTGAACGCACTAAACCCATGATT
>probe:Drosophila_2:1641372_at:174:201; Interrogation_Position=1206; Antisense; AACCCATGATTTCCATTACTCCATT
>probe:Drosophila_2:1641372_at:580:177; Interrogation_Position=1249; Antisense; AAACTTATGTGTAATCCCATCGGGA
>probe:Drosophila_2:1641372_at:668:235; Interrogation_Position=1261; Antisense; AATCCCATCGGGAGCTGGTGTTGCA
>probe:Drosophila_2:1641372_at:534:469; Interrogation_Position=1280; Antisense; GTTGCATTGCGTTCCATGTGATTAT
>probe:Drosophila_2:1641372_at:25:583; Interrogation_Position=877; Antisense; TGGCGCCGTTTGAAGGTGATCTTAT
>probe:Drosophila_2:1641372_at:208:513; Interrogation_Position=892; Antisense; GTGATCTTATACAGTTCTAACCCAA

Paste this into a BLAST search page for me
ATATTTGGCCATGTCACTGTTCCACACCACATCCGGTTTGAGTTCATTCGTGAGTTCATTCGATTCCAACGCGTCGTCCAACCAAAGACGTTTCAATCGCTTCAATCGCAAACATTCGGCTATCGTTTCATTTTTCGTTTGTTGCATCGGGTTGCATCGGTTGCATCCAATCGAAGATTGAACGCACTAAACCCATGATTAACCCATGATTTCCATTACTCCATTAAACTTATGTGTAATCCCATCGGGAAATCCCATCGGGAGCTGGTGTTGCAGTTGCATTGCGTTCCATGTGATTATTGGCGCCGTTTGAAGGTGATCTTATGTGATCTTATACAGTTCTAACCCAA

Full Affymetrix probeset data:

Annotations for 1641372_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime