FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641373_at:

>probe:Drosophila_2:1641373_at:114:377; Interrogation_Position=1026; Antisense; GAAGCACTGGCCTCACAAGGAAACA
>probe:Drosophila_2:1641373_at:724:389; Interrogation_Position=1045; Antisense; GAAACAATCCCTTCTCTAGTTAATT
>probe:Drosophila_2:1641373_at:135:183; Interrogation_Position=501; Antisense; AAAATCGGAGCCTGCGTCAAGCCCT
>probe:Drosophila_2:1641373_at:592:279; Interrogation_Position=524; Antisense; CTGCCTGGTGTTCAATGGTCCGAAA
>probe:Drosophila_2:1641373_at:596:153; Interrogation_Position=554; Antisense; ACAGACCGAGGAACTGAGGCGCCTT
>probe:Drosophila_2:1641373_at:442:449; Interrogation_Position=623; Antisense; GATCCGGCTGCAGGGCATCGAACAC
>probe:Drosophila_2:1641373_at:530:471; Interrogation_Position=648; Antisense; GTTCTGAGTTTCACGGTTACCGATG
>probe:Drosophila_2:1641373_at:707:385; Interrogation_Position=677; Antisense; GAACATACTGATGCGTTCCTACCGG
>probe:Drosophila_2:1641373_at:709:469; Interrogation_Position=691; Antisense; GTTCCTACCGGATACTGCTGAAGAA
>probe:Drosophila_2:1641373_at:301:75; Interrogation_Position=726; Antisense; AGGACGCCGCGCATAGAGCTTGAAG
>probe:Drosophila_2:1641373_at:712:115; Interrogation_Position=742; Antisense; AGCTTGAAGAGATCGGACCCTCGGC
>probe:Drosophila_2:1641373_at:656:209; Interrogation_Position=858; Antisense; AAGAACATTAGCACAGACGCCCTGG
>probe:Drosophila_2:1641373_at:163:81; Interrogation_Position=892; Antisense; AGGGACGTGTCCATCTGGGCAAGCA
>probe:Drosophila_2:1641373_at:368:593; Interrogation_Position=907; Antisense; TGGGCAAGCAGCAAACGGGCTCCAT

Paste this into a BLAST search page for me
GAAGCACTGGCCTCACAAGGAAACAGAAACAATCCCTTCTCTAGTTAATTAAAATCGGAGCCTGCGTCAAGCCCTCTGCCTGGTGTTCAATGGTCCGAAAACAGACCGAGGAACTGAGGCGCCTTGATCCGGCTGCAGGGCATCGAACACGTTCTGAGTTTCACGGTTACCGATGGAACATACTGATGCGTTCCTACCGGGTTCCTACCGGATACTGCTGAAGAAAGGACGCCGCGCATAGAGCTTGAAGAGCTTGAAGAGATCGGACCCTCGGCAAGAACATTAGCACAGACGCCCTGGAGGGACGTGTCCATCTGGGCAAGCATGGGCAAGCAGCAAACGGGCTCCAT

Full Affymetrix probeset data:

Annotations for 1641373_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720