Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641375_at:

>probe:Drosophila_2:1641375_at:45:231; Interrogation_Position=153; Antisense; AATGTGCACGACTTGCCTGGACAAT
>probe:Drosophila_2:1641375_at:379:349; Interrogation_Position=180; Antisense; GCAGGCAGCCATTAAGTTCCGCCAG
>probe:Drosophila_2:1641375_at:399:123; Interrogation_Position=203; Antisense; AGCGCTGCATCATTGCCGAGAAACA
>probe:Drosophila_2:1641375_at:679:361; Interrogation_Position=254; Antisense; GCAAGGATTGCTCCACAGATCCAAT
>probe:Drosophila_2:1641375_at:523:137; Interrogation_Position=323; Antisense; ACGAGTCCATTCTATGTCCTGAAGT
>probe:Drosophila_2:1641375_at:337:97; Interrogation_Position=351; Antisense; AGATCTTCCAATGCCAAGTGCTGAA
>probe:Drosophila_2:1641375_at:588:213; Interrogation_Position=376; Antisense; AAGGTCTCAGCACCGACTAGTTTGA
>probe:Drosophila_2:1641375_at:218:383; Interrogation_Position=439; Antisense; GAACTGACTAGCCATACGCGTATCC
>probe:Drosophila_2:1641375_at:326:419; Interrogation_Position=472; Antisense; GAGCAGCCATACGTGTGCGTCTACT
>probe:Drosophila_2:1641375_at:469:297; Interrogation_Position=562; Antisense; CGCTACGAGTGCGACACGTGCAAAA
>probe:Drosophila_2:1641375_at:364:91; Interrogation_Position=589; Antisense; AGTTTTGTAAGCTCCGGATGTCTCA
>probe:Drosophila_2:1641375_at:219:49; Interrogation_Position=628; Antisense; ATCCATGTGGATGCGCGGAATCACT
>probe:Drosophila_2:1641375_at:69:729; Interrogation_Position=68; Antisense; TTGGTCCAGGAAACGGTCATCTAGT
>probe:Drosophila_2:1641375_at:58:37; Interrogation_Position=91; Antisense; GTTCGTCAAATTCACTCCATTACTG

Paste this into a BLAST search page for me
AATGTGCACGACTTGCCTGGACAATGCAGGCAGCCATTAAGTTCCGCCAGAGCGCTGCATCATTGCCGAGAAACAGCAAGGATTGCTCCACAGATCCAATACGAGTCCATTCTATGTCCTGAAGTAGATCTTCCAATGCCAAGTGCTGAAAAGGTCTCAGCACCGACTAGTTTGAGAACTGACTAGCCATACGCGTATCCGAGCAGCCATACGTGTGCGTCTACTCGCTACGAGTGCGACACGTGCAAAAAGTTTTGTAAGCTCCGGATGTCTCAATCCATGTGGATGCGCGGAATCACTTTGGTCCAGGAAACGGTCATCTAGTGTTCGTCAAATTCACTCCATTACTG

Full Affymetrix probeset data:

Annotations for 1641375_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime