Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641378_at:

>probe:Drosophila_2:1641378_at:300:73; Interrogation_Position=2826; Antisense; AGGAACTCGAAACGCCATTCAAGCT
>probe:Drosophila_2:1641378_at:616:271; Interrogation_Position=2841; Antisense; CATTCAAGCTCTCTGGCCTTAGTGC
>probe:Drosophila_2:1641378_at:56:627; Interrogation_Position=2863; Antisense; TGCCAATCCATATCTATTCACAACC
>probe:Drosophila_2:1641378_at:488:221; Interrogation_Position=2891; Antisense; AAGGTGGTAATCCTGTCGGCCCTAT
>probe:Drosophila_2:1641378_at:680:305; Interrogation_Position=2911; Antisense; CCTATCGGGCGTGCTTAGCGAAGTT
>probe:Drosophila_2:1641378_at:101:217; Interrogation_Position=2972; Antisense; AAGTAACCTATGCAAGGCGCAGACC
>probe:Drosophila_2:1641378_at:205:577; Interrogation_Position=2987; Antisense; GGCGCAGACCCATCATATTTTTGTA
>probe:Drosophila_2:1641378_at:446:415; Interrogation_Position=3086; Antisense; GAGCCAATGTTTATGCTTGTCACGT
>probe:Drosophila_2:1641378_at:117:663; Interrogation_Position=3127; Antisense; TAACAAGCCCACTAACGACTACGTA
>probe:Drosophila_2:1641378_at:572:15; Interrogation_Position=3169; Antisense; ATTTACCTACTTACCTTCTAGAGCG
>probe:Drosophila_2:1641378_at:521:677; Interrogation_Position=3187; Antisense; TAGAGCGACCTGCACAATCACAAAT
>probe:Drosophila_2:1641378_at:219:509; Interrogation_Position=3280; Antisense; GTGCACCTATTGTAGTTGGCTGTTC
>probe:Drosophila_2:1641378_at:436:573; Interrogation_Position=3297; Antisense; GGCTGTTCATTCTGTTACAGTCCCA
>probe:Drosophila_2:1641378_at:188:227; Interrogation_Position=3334; Antisense; AAGGCGGTCTCAGCTAGTGTTGCAA

Paste this into a BLAST search page for me
AGGAACTCGAAACGCCATTCAAGCTCATTCAAGCTCTCTGGCCTTAGTGCTGCCAATCCATATCTATTCACAACCAAGGTGGTAATCCTGTCGGCCCTATCCTATCGGGCGTGCTTAGCGAAGTTAAGTAACCTATGCAAGGCGCAGACCGGCGCAGACCCATCATATTTTTGTAGAGCCAATGTTTATGCTTGTCACGTTAACAAGCCCACTAACGACTACGTAATTTACCTACTTACCTTCTAGAGCGTAGAGCGACCTGCACAATCACAAATGTGCACCTATTGTAGTTGGCTGTTCGGCTGTTCATTCTGTTACAGTCCCAAAGGCGGTCTCAGCTAGTGTTGCAA

Full Affymetrix probeset data:

Annotations for 1641378_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime