Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641382_at:

>probe:Drosophila_2:1641382_at:344:499; Interrogation_Position=2456; Antisense; GTCTGTTGGGCAAGCCGCACAGCAA
>probe:Drosophila_2:1641382_at:225:445; Interrogation_Position=2509; Antisense; GATGAGCTCATTTTTATGCTGCAAG
>probe:Drosophila_2:1641382_at:697:51; Interrogation_Position=2524; Antisense; ATGCTGCAAGATGCGCCCGAAGGCA
>probe:Drosophila_2:1641382_at:673:37; Interrogation_Position=2551; Antisense; ATCTGTCGCCCGTCTAGGGTGCGAG
>probe:Drosophila_2:1641382_at:227:81; Interrogation_Position=2566; Antisense; AGGGTGCGAGCTATGTTTGCCTCAC
>probe:Drosophila_2:1641382_at:308:693; Interrogation_Position=2581; Antisense; TTTGCCTCACGTGCTTGCCGAAAAT
>probe:Drosophila_2:1641382_at:39:43; Interrogation_Position=2604; Antisense; ATCGGTGATGATTGGTACAGCTCTT
>probe:Drosophila_2:1641382_at:281:133; Interrogation_Position=2620; Antisense; ACAGCTCTTAGCAGGAATACAACGA
>probe:Drosophila_2:1641382_at:642:385; Interrogation_Position=2677; Antisense; GAACAGCCATGGAACTGTCCACATG
>probe:Drosophila_2:1641382_at:566:153; Interrogation_Position=2697; Antisense; ACATGGACGTCCTACGATGCGACAC
>probe:Drosophila_2:1641382_at:480:399; Interrogation_Position=2717; Antisense; GACACCTCATAAACATCGCAATGCT
>probe:Drosophila_2:1641382_at:489:91; Interrogation_Position=2769; Antisense; AGAGCCTCCGGCCTAATAGAAACGA
>probe:Drosophila_2:1641382_at:592:707; Interrogation_Position=2844; Antisense; TTAACTTTTCGTTTGAGCCACTAAG
>probe:Drosophila_2:1641382_at:184:415; Interrogation_Position=2858; Antisense; GAGCCACTAAGTATACGTCATTGTT

Paste this into a BLAST search page for me
GTCTGTTGGGCAAGCCGCACAGCAAGATGAGCTCATTTTTATGCTGCAAGATGCTGCAAGATGCGCCCGAAGGCAATCTGTCGCCCGTCTAGGGTGCGAGAGGGTGCGAGCTATGTTTGCCTCACTTTGCCTCACGTGCTTGCCGAAAATATCGGTGATGATTGGTACAGCTCTTACAGCTCTTAGCAGGAATACAACGAGAACAGCCATGGAACTGTCCACATGACATGGACGTCCTACGATGCGACACGACACCTCATAAACATCGCAATGCTAGAGCCTCCGGCCTAATAGAAACGATTAACTTTTCGTTTGAGCCACTAAGGAGCCACTAAGTATACGTCATTGTT

Full Affymetrix probeset data:

Annotations for 1641382_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime