FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641386_at:

>probe:Drosophila_2:1641386_at:372:17; Interrogation_Position=1010; Antisense; ATTTTTTCGATCTTCATTTGCAGGA
>probe:Drosophila_2:1641386_at:379:441; Interrogation_Position=1033; Antisense; GATGGTTCGGATTTTGACCCACATT
>probe:Drosophila_2:1641386_at:384:577; Interrogation_Position=1067; Antisense; GGCGCGTTCGTGTGCTTCTCAACAT
>probe:Drosophila_2:1641386_at:654:143; Interrogation_Position=569; Antisense; ACTGCAGCGGTAAACGGTCGACGTC
>probe:Drosophila_2:1641386_at:144:407; Interrogation_Position=588; Antisense; GACGTCTGAGTACTGGGACACCTTC
>probe:Drosophila_2:1641386_at:710:557; Interrogation_Position=603; Antisense; GGACACCTTCTCGAATTGTGCTCGT
>probe:Drosophila_2:1641386_at:442:397; Interrogation_Position=639; Antisense; GACAAGTGTCCCATCCATTTTAAAA
>probe:Drosophila_2:1641386_at:400:161; Interrogation_Position=666; Antisense; ACAAGTGCAGAGGAGCCGACGGCTC
>probe:Drosophila_2:1641386_at:130:89; Interrogation_Position=694; Antisense; CGTCCCGTACACACGACAAGTGATG
>probe:Drosophila_2:1641386_at:497:409; Interrogation_Position=718; Antisense; GACGAAGTGCGTCAGCTTTACAAAA
>probe:Drosophila_2:1641386_at:101:321; Interrogation_Position=822; Antisense; GCCGCCCAAATTTTCACCCAGAAGT
>probe:Drosophila_2:1641386_at:518:107; Interrogation_Position=841; Antisense; AGAAGTAACCAGAAGCCCAACGCTT
>probe:Drosophila_2:1641386_at:429:677; Interrogation_Position=879; Antisense; TAGTCAGAAGTCACCCGAAGATGTT
>probe:Drosophila_2:1641386_at:258:195; Interrogation_Position=944; Antisense; AACTGCGTGGTGAACCGATTCCGGA

Paste this into a BLAST search page for me
ATTTTTTCGATCTTCATTTGCAGGAGATGGTTCGGATTTTGACCCACATTGGCGCGTTCGTGTGCTTCTCAACATACTGCAGCGGTAAACGGTCGACGTCGACGTCTGAGTACTGGGACACCTTCGGACACCTTCTCGAATTGTGCTCGTGACAAGTGTCCCATCCATTTTAAAAACAAGTGCAGAGGAGCCGACGGCTCCGTCCCGTACACACGACAAGTGATGGACGAAGTGCGTCAGCTTTACAAAAGCCGCCCAAATTTTCACCCAGAAGTAGAAGTAACCAGAAGCCCAACGCTTTAGTCAGAAGTCACCCGAAGATGTTAACTGCGTGGTGAACCGATTCCGGA

Full Affymetrix probeset data:

Annotations for 1641386_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720