FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641387_at:

>probe:Drosophila_2:1641387_at:557:519; Interrogation_Position=115; Antisense; GTGGATCTGGTGAACTTCCAGTACT
>probe:Drosophila_2:1641387_at:346:489; Interrogation_Position=135; Antisense; GTACTTCAAGAACCTGGCATCGCAG
>probe:Drosophila_2:1641387_at:499:299; Interrogation_Position=180; Antisense; CGCCAATCCACTGCTGGTGCATTTT
>probe:Drosophila_2:1641387_at:181:241; Interrogation_Position=20; Antisense; AATACGTATTAATTGCTGCACTGGC
>probe:Drosophila_2:1641387_at:552:709; Interrogation_Position=28; Antisense; TTAATTGCTGCACTGGCCGTAATGT
>probe:Drosophila_2:1641387_at:229:583; Interrogation_Position=310; Antisense; TGGCGTCCGGTCTACGAGCGAAAGT
>probe:Drosophila_2:1641387_at:539:171; Interrogation_Position=330; Antisense; AAAGTTTGGCTATCGCGGAGAGCGC
>probe:Drosophila_2:1641387_at:622:101; Interrogation_Position=348; Antisense; AGAGCGCCTAATCGCTGCCCTGGGA
>probe:Drosophila_2:1641387_at:33:539; Interrogation_Position=377; Antisense; GGTATTCGGTGCCACAACTGCGCCA
>probe:Drosophila_2:1641387_at:504:687; Interrogation_Position=403; Antisense; TTTGGCGCCATTCCCCGCGAGTATG
>probe:Drosophila_2:1641387_at:334:327; Interrogation_Position=419; Antisense; GCGAGTATGGCACACCGCACTATCC
>probe:Drosophila_2:1641387_at:337:657; Interrogation_Position=47; Antisense; TAATGTGCTCCTCGGTGCGAGTCCA
>probe:Drosophila_2:1641387_at:459:431; Interrogation_Position=65; Antisense; GAGTCCAAGCCACGCTGCACGATCT
>probe:Drosophila_2:1641387_at:546:537; Interrogation_Position=96; Antisense; GGTCTTTGACTTCTCCAATGTGGAT

Paste this into a BLAST search page for me
GTGGATCTGGTGAACTTCCAGTACTGTACTTCAAGAACCTGGCATCGCAGCGCCAATCCACTGCTGGTGCATTTTAATACGTATTAATTGCTGCACTGGCTTAATTGCTGCACTGGCCGTAATGTTGGCGTCCGGTCTACGAGCGAAAGTAAAGTTTGGCTATCGCGGAGAGCGCAGAGCGCCTAATCGCTGCCCTGGGAGGTATTCGGTGCCACAACTGCGCCATTTGGCGCCATTCCCCGCGAGTATGGCGAGTATGGCACACCGCACTATCCTAATGTGCTCCTCGGTGCGAGTCCAGAGTCCAAGCCACGCTGCACGATCTGGTCTTTGACTTCTCCAATGTGGAT

Full Affymetrix probeset data:

Annotations for 1641387_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720