Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641389_at:

>probe:Drosophila_2:1641389_at:548:137; Interrogation_Position=1009; Antisense; ACGAGGAGGGCAATCGGATTCCCCA
>probe:Drosophila_2:1641389_at:234:83; Interrogation_Position=1015; Antisense; AGGGCAATCGGATTCCCCATCTGTG
>probe:Drosophila_2:1641389_at:200:11; Interrogation_Position=1026; Antisense; ATTCCCCATCTGTGCGCCAATGAGA
>probe:Drosophila_2:1641389_at:689:641; Interrogation_Position=1034; Antisense; TCTGTGCGCCAATGAGACGAGCTTT
>probe:Drosophila_2:1641389_at:684:505; Interrogation_Position=1037; Antisense; GTGCGCCAATGAGACGAGCTTTAAC
>probe:Drosophila_2:1641389_at:82:425; Interrogation_Position=1047; Antisense; GAGACGAGCTTTAACCAGGAGTACA
>probe:Drosophila_2:1641389_at:404:709; Interrogation_Position=1057; Antisense; TTAACCAGGAGTACAGAATCTGTGA
>probe:Drosophila_2:1641389_at:41:367; Interrogation_Position=1072; Antisense; GAATCTGTGATTGGGACTACAACTT
>probe:Drosophila_2:1641389_at:635:527; Interrogation_Position=1084; Antisense; GGGACTACAACTTTAACTGCACAGA
>probe:Drosophila_2:1641389_at:100:147; Interrogation_Position=1093; Antisense; ACTTTAACTGCACAGAGTCACCCGT
>probe:Drosophila_2:1641389_at:563:707; Interrogation_Position=1096; Antisense; TTAACTGCACAGAGTCACCCGTAAG
>probe:Drosophila_2:1641389_at:111:143; Interrogation_Position=1099; Antisense; ACTGCACAGAGTCACCCGTAAGATT
>probe:Drosophila_2:1641389_at:51:153; Interrogation_Position=1104; Antisense; ACAGAGTCACCCGTAAGATTACTGA
>probe:Drosophila_2:1641389_at:270:491; Interrogation_Position=1109; Antisense; GTCACCCGTAAGATTACTGAACGAT

Paste this into a BLAST search page for me
ACGAGGAGGGCAATCGGATTCCCCAAGGGCAATCGGATTCCCCATCTGTGATTCCCCATCTGTGCGCCAATGAGATCTGTGCGCCAATGAGACGAGCTTTGTGCGCCAATGAGACGAGCTTTAACGAGACGAGCTTTAACCAGGAGTACATTAACCAGGAGTACAGAATCTGTGAGAATCTGTGATTGGGACTACAACTTGGGACTACAACTTTAACTGCACAGAACTTTAACTGCACAGAGTCACCCGTTTAACTGCACAGAGTCACCCGTAAGACTGCACAGAGTCACCCGTAAGATTACAGAGTCACCCGTAAGATTACTGAGTCACCCGTAAGATTACTGAACGAT

Full Affymetrix probeset data:

Annotations for 1641389_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime