Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641390_at:

>probe:Drosophila_2:1641390_at:494:25; Interrogation_Position=1809; Antisense; ATAGACTTCCATTACATGCAATGTA
>probe:Drosophila_2:1641390_at:104:423; Interrogation_Position=1853; Antisense; GAGAATTCACGAACTTGTTACCACA
>probe:Drosophila_2:1641390_at:121:273; Interrogation_Position=1983; Antisense; CATATTTATTGACTGGTACTGGTAC
>probe:Drosophila_2:1641390_at:326:535; Interrogation_Position=1997; Antisense; GGTACTGGTACTGACATTTTAATGT
>probe:Drosophila_2:1641390_at:355:173; Interrogation_Position=2057; Antisense; AAAGCCATACAGATTTGTTACCTAA
>probe:Drosophila_2:1641390_at:203:193; Interrogation_Position=2083; Antisense; AACTCGGAAAATTTGATCGTCACCT
>probe:Drosophila_2:1641390_at:231:451; Interrogation_Position=2097; Antisense; GATCGTCACCTTTAAACTGTTATTC
>probe:Drosophila_2:1641390_at:207:285; Interrogation_Position=2113; Antisense; CTGTTATTCTGCTCAGTGTTCGATA
>probe:Drosophila_2:1641390_at:462:465; Interrogation_Position=2149; Antisense; GATTGATTTATGTAAGCACCTTTAG
>probe:Drosophila_2:1641390_at:371:19; Interrogation_Position=2215; Antisense; ATATTACTTCCGTGAGCGTTTTCAA
>probe:Drosophila_2:1641390_at:28:207; Interrogation_Position=2240; Antisense; AAGCGCTGTCTTCAATCCAAAATGG
>probe:Drosophila_2:1641390_at:611:349; Interrogation_Position=2265; Antisense; GCAGAAGTGCCAGTTTCGTTTTGTT
>probe:Drosophila_2:1641390_at:164:477; Interrogation_Position=2287; Antisense; GTTTACCCTCGAATACGGAGTGCAA
>probe:Drosophila_2:1641390_at:217:691; Interrogation_Position=2326; Antisense; TTTGTTGCCGACATAAGAACGTTTT

Paste this into a BLAST search page for me
ATAGACTTCCATTACATGCAATGTAGAGAATTCACGAACTTGTTACCACACATATTTATTGACTGGTACTGGTACGGTACTGGTACTGACATTTTAATGTAAAGCCATACAGATTTGTTACCTAAAACTCGGAAAATTTGATCGTCACCTGATCGTCACCTTTAAACTGTTATTCCTGTTATTCTGCTCAGTGTTCGATAGATTGATTTATGTAAGCACCTTTAGATATTACTTCCGTGAGCGTTTTCAAAAGCGCTGTCTTCAATCCAAAATGGGCAGAAGTGCCAGTTTCGTTTTGTTGTTTACCCTCGAATACGGAGTGCAATTTGTTGCCGACATAAGAACGTTTT

Full Affymetrix probeset data:

Annotations for 1641390_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime