Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641391_at:

>probe:Drosophila_2:1641391_at:656:65; Interrogation_Position=103; Antisense; ATGGAGAGTCAGCTGCCAGGACCAC
>probe:Drosophila_2:1641391_at:443:261; Interrogation_Position=147; Antisense; CACCGCCTCGAGCATTGGCTATAAT
>probe:Drosophila_2:1641391_at:404:3; Interrogation_Position=160; Antisense; ATTGGCTATAATCCGCTCAACGACG
>probe:Drosophila_2:1641391_at:235:253; Interrogation_Position=177; Antisense; CAACGACGACGACTGGTGGGCCAAT
>probe:Drosophila_2:1641391_at:420:557; Interrogation_Position=18; Antisense; GGACATTTACCAGGATGCCAGCACC
>probe:Drosophila_2:1641391_at:271:143; Interrogation_Position=188; Antisense; ACTGGTGGGCCAATGCCATCGAAGT
>probe:Drosophila_2:1641391_at:41:333; Interrogation_Position=231; Antisense; GCTGGCCTTCGATGCTAGCGAAAAT
>probe:Drosophila_2:1641391_at:691:497; Interrogation_Position=257; Antisense; GTCTGTGGAACGGACACTTTGTGCC
>probe:Drosophila_2:1641391_at:236:711; Interrogation_Position=301; Antisense; TTCCTGGATGAAAGCGTCGCCGCCG
>probe:Drosophila_2:1641391_at:20:611; Interrogation_Position=332; Antisense; TGACCACCTGTGATCTGTGCACGTG
>probe:Drosophila_2:1641391_at:560:669; Interrogation_Position=376; Antisense; TACTCCCTGGATGGTTCCATAGGTG
>probe:Drosophila_2:1641391_at:372:77; Interrogation_Position=396; Antisense; AGGTGAGTACCGATGGTTCCTTCTC
>probe:Drosophila_2:1641391_at:107:643; Interrogation_Position=445; Antisense; TCTGCTCCTGTCGTTTTTCAATTAA
>probe:Drosophila_2:1641391_at:473:211; Interrogation_Position=481; Antisense; AAGACAATAATCTGGCGGCCGTGCA

Paste this into a BLAST search page for me
ATGGAGAGTCAGCTGCCAGGACCACCACCGCCTCGAGCATTGGCTATAATATTGGCTATAATCCGCTCAACGACGCAACGACGACGACTGGTGGGCCAATGGACATTTACCAGGATGCCAGCACCACTGGTGGGCCAATGCCATCGAAGTGCTGGCCTTCGATGCTAGCGAAAATGTCTGTGGAACGGACACTTTGTGCCTTCCTGGATGAAAGCGTCGCCGCCGTGACCACCTGTGATCTGTGCACGTGTACTCCCTGGATGGTTCCATAGGTGAGGTGAGTACCGATGGTTCCTTCTCTCTGCTCCTGTCGTTTTTCAATTAAAAGACAATAATCTGGCGGCCGTGCA

Full Affymetrix probeset data:

Annotations for 1641391_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime