FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641393_at:

>probe:Drosophila_2:1641393_at:580:373; Interrogation_Position=421; Antisense; GAAGTCGCTGGAGTACAATCGCAAC
>probe:Drosophila_2:1641393_at:526:663; Interrogation_Position=434; Antisense; TACAATCGCAACCACCCGGAGGAGG
>probe:Drosophila_2:1641393_at:58:57; Interrogation_Position=489; Antisense; ATGACCACCATGAGCATCACCAGAG
>probe:Drosophila_2:1641393_at:124:35; Interrogation_Position=504; Antisense; ATCACCAGAGCCATGGTCAGGAGCA
>probe:Drosophila_2:1641393_at:347:45; Interrogation_Position=577; Antisense; ATCGCCAGTGTTGTCTGTGGGTCAG
>probe:Drosophila_2:1641393_at:556:535; Interrogation_Position=601; Antisense; GGTCCTGCCCTACGACAGGAAGCTA
>probe:Drosophila_2:1641393_at:712:31; Interrogation_Position=625; Antisense; ATAATGCTGCATCCGTCCATTGCAT
>probe:Drosophila_2:1641393_at:487:37; Interrogation_Position=667; Antisense; ATCTTGTCCAGCTGTCCATGTTGTT
>probe:Drosophila_2:1641393_at:727:315; Interrogation_Position=692; Antisense; GCCTGTCTGTTTGCATAGTCCATAG
>probe:Drosophila_2:1641393_at:352:677; Interrogation_Position=707; Antisense; TAGTCCATAGACCATCCAACATACG
>probe:Drosophila_2:1641393_at:407:309; Interrogation_Position=722; Antisense; CCAACATACGGCATCCAGCATATAT
>probe:Drosophila_2:1641393_at:1:43; Interrogation_Position=774; Antisense; ATCGGAGCAACTACATCTGGACGCG
>probe:Drosophila_2:1641393_at:312:647; Interrogation_Position=861; Antisense; TCATACATTTCCATCAACATGCTCC
>probe:Drosophila_2:1641393_at:65:289; Interrogation_Position=948; Antisense; CGGCTCGACTGACGTTGACATTTAT

Paste this into a BLAST search page for me
GAAGTCGCTGGAGTACAATCGCAACTACAATCGCAACCACCCGGAGGAGGATGACCACCATGAGCATCACCAGAGATCACCAGAGCCATGGTCAGGAGCAATCGCCAGTGTTGTCTGTGGGTCAGGGTCCTGCCCTACGACAGGAAGCTAATAATGCTGCATCCGTCCATTGCATATCTTGTCCAGCTGTCCATGTTGTTGCCTGTCTGTTTGCATAGTCCATAGTAGTCCATAGACCATCCAACATACGCCAACATACGGCATCCAGCATATATATCGGAGCAACTACATCTGGACGCGTCATACATTTCCATCAACATGCTCCCGGCTCGACTGACGTTGACATTTAT

Full Affymetrix probeset data:

Annotations for 1641393_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720